Arquivo da categoria ‘Genética’

ANÁLISE E INTERPRETAÇÃO DE HEREDOGRAMAS

Publicado: 30 de outubro de 2013 em Genética

Um dos tópicos mais exigidos em provas de vestibular é a capacidade do aluno interpretar heredogramas ou genealogias, que representam o padrão de hereditariedade de determinada característica em uma família ao longo das gerações. Sendo assim, para auxiliar os alunos na resolução destas questões podemos seguir às seguintes regras:

 

1ª) A presença de pais normais gerando filhos doentes ou portadores de determinada característica indica que tal caráter é RECESSIVO.

2ª) Se a característica for recessiva e ambos os pais (pai e mãe) apresentarem esta característica, todos os seus filhos deverão apresentar esta característica e serão recessivos também. Esta regra é válida tanto para casos de herança autossômica, quanto para casos de herança ligada ao cromossomo X.

3ª)Para saber se é um caso de herança autossômica ou ligada ao X é preciso efetuar cruzamentos-teste entre indivíduos para verificar a possibilidade, mas podemos também seguir às seguintes regras:

 

– Se o caráter for dominante e ligado ao X e ambos os pais possuírem esta característica e a mãe for homozigota para ela, todos os filhos deste casal deverão possuir a característica.

 

XH

Y

XH

XHXH

XHY

XH

XHXH

XHY

 

Se o caráter for dominante e ligado ao X e ambos os pais possuírem esta característica e a mãe for heterozigota para ela, todas as filhas mulheres deverão possuir a característica, enquanto os filhos homens poderão ou não possuir a característica.

 

XH

Y

XH

XHXH

XHY

Xh

XHXh

XhY

 

– Se o caráter for dominante e ligado ao X e nenhum dos pais possuírem a característica, nenhum dos filhos poderá possuir a característica.

 

Xh

Y

Xh

XhXh

XhY

Xh

XhXh

XhY

 

 

– Se o caráter for dominante e ligado ao X e somente o pai possuir esta característica, apenas as filhas mulheres apresentarão a característica.

 

XH

Y

Xh

XHXh

XhY

Xh

XHXh

XhY

 

– Se o caráter for dominante e ligado ao X e somente a mãe possuir a característica, sendo ela homozigota, todos os filhos (homens e mulheres) possuirão a característica. 

 

Xh

Y

XH

XHXh

XHY

XH

XHXh

XHY

 

– Se o caráter for dominante e ligado ao X e somente a mãe apresentar a característica, sendo ela heterozigota, tanto os filhos homens quanto as filhas mulheres poderão apresentar ou não a característica em igual probabilidade.

 

Xh

Y

XH

XHXh

XHY

Xh

XhXh

XhY

 

– Se o caráter for recessivo e ligado ao X e ambos os pais possuírem esta característica, todos os seus descendentes deverão possuir a mesma característica que os pais. 

 

Xh

Y

Xh

XhXh

XhY

Xh

XhXh

XhY

 

– Se o caráter for recessivo e ligado ao X e nenhum dos pais possuírem a característica e a mãe for homozigota para ela, nenhum dos filhos poderá ter a característica.

 

XH

Y

XH

XHXH

XHY

XH

XHXH

XHY

Se o caráter for recessivo e ligado ao X e nenhum dos pais possuírem a característica e a mãe for heterozigota para ela, somente os filhos homens poderão apresentar a característica.

 

XH

Y

XH

XHXH

XHY

Xh

XHXh

XhY

Outro ponto importante é que características ligadas ao cromossomo X tendem a ser mais frequentes nos homens, visto que estes só possuem um único cromossomo X, ou seja, basta possuir um único alelo para ter a característica.

 

4ª) Os caracteres ligados ao cromossomo Y só estão presentes em homens, mas cuidado! O simples fato de só haverem homens afetados por determinada característica não significa que é um caso de herança ligada ao cromossomo Y. Para ser uma herança ligada ao Y é necessário que todos os homens descendentes diretos ou indiretos de um homem que apresente a característica também possuam a mesma característica. Vejamos o seguinte exemplo:

 

– João apresenta hipertricose auricular (caráter ligado ao Y) e casou-se com Maria, tendo quatro filhos, dois homens (Thiago e Marcelo) e duas mulheres (Renata e Carla). Todos os seus filhos se casaram e, cada um deles, teve um casal de filhos. Quantos netos de João apresentarão hipertricose auricular? Repare o seguinte, por se tratar de um caráter ligado ao Y, somente os dois filhos homens de João irão herdar esta característica, ou seja, Thiago e Marcelo. Portanto, somente os filhos homens de Thiago e Marcelo herdarão esta mesma característica de seus pais, ou seja, dois netos.

 

Utilizando as regras acima, vocês poderão determinar se o caráter é ligado ao cromossomo X ou autossômico. Por fim, lembrem-se que a primeira etapa na interpretação de um heredograma é determinar se é uma herança dominante ou recessiva. Após isso, vocês poderão determinar se é um caso de herança autossômica ou ligada ao X.

Anúncios

CÓDIGO GENÉTICO X SÍNTESE DE PROTEÍNAS

Publicado: 5 de agosto de 2013 em Genética

Um dos tópicos mais comumente abordados nos exames de qualificação da UERJ é a relação entre o código genético e a síntese de proteínas.

RELEMBRANDO…

Se recordarmos tal assunto, teremos algumas informações essenciais:

– A informação genética está contida no DNA das nossas células. Tal informação poderá ser transcrita, produzindo uma molécula de RNA mensageiro. Esta, por sua vez, poderá ser traduzida, produzindo uma proteína. Sendo assim, as características genéticas apresentadas por uma dada espécie (ou mesmo indivíduo) se deve à produção de proteínas.

– Mas como a célula consegue determinar a sequência correta de aminoácidos de cada proteína a partir do RNA mensageiro? A resposta é simples. O código genético é um código de trincas. Nesse caso, cada trinca de nucleotídeos (códons) presentes no RNAm indicará um determinado aminoácido, como apresentado abaixo:

Mas a maioria das questões relacionadas com este assunto abordam a ocorrência de mutações (alterações na sequência de nucleotídeos no DNA e, consequentemente, no RNAm) e questionam se haverá troca de aminoácidos na estrutura das proteínas. Para resolver este tipo de questão, devemos lembrar de outro ponto importante:

“O código genético é degenerado.”

A afirmação acima indica que um mesmo aminoácido pode ser codificado por vários códons. Por exemplo, a alanina pode ser codificado por quatro códons distintos: GCA, GCU, GCG e GCC. Sendo assim, mutações poderão ocorrer, sem provocar mudança no aminoácido codificado.

Para vermos esta aplicabilidade, vamos analisar uma questão da UERJ sobre esse assunto:

 

1) (UERJ -2005)

A mutação em um gene, por conseqüência da substituição de uma única base na estrutura do DNA, pode acarretar modificações importantes na atividade biológica da proteína codificada por esse gene. Considere que a estrutura normal de um RNA mensageiro de um peptídio e sua estrutura alterada em virtude da troca de uma única base no gene correspondente são:

5’ AUGUGGUUUGCACACAAAUGAUAA 3’ (normal)
5’ AUGUGGUUUGAACACAAAUGAUAA 3’ (alterada)

A tabela abaixo identifica alguns códons.

Observe que:
– o códon da metionina é também o do início da tradução;
– os códons de término da tradução são UAA, UAG e UGA.

O aminoácido encontrado no peptídio normal e aquele que o substituiu no peptídio mutante são, respectivamente:
(A) lisina e cisteína
(B) treonina e triptofano
(C) alanina e ácido glutâmico
(D) fenilalanina e ácido aspártico

COMENTÁRIOS

Nesta questão, é abordada a ocorrência de uma determinada mutação. Para que o aluno possa identificá-la, o enunciado as sequência de RNAm normal e alterada. Após isso, o enunciado fornece uma tabela contendo os principais códons e seus respectivos aminoácidos. Essas são as informações que permitirão a resolução da questão.

Após isso, devemos verificar qual a pergunta da questão. Nesse caso, ele pergunta: “Qual o aminoácido é encontrado na proteína normal e na alterada? A resolução é simples. Sabemos que os aminoácidos são codificados por trincas de nucleotídeos. Logo, basta verificarmos quais os códons encontrados em cada sequência (normal e alterada). Quando você analisar estas sequências, verificará que a sequência normal possui um códon GCA, enquanto a sequência alterada possui um códon GAA. Uma vez que sabemos onde ocorreu a mutação e quais os códons normal e alterado, basta buscarmos a informação na tabela. Sendo assim, verificamos que GCA é um códon que indica alanina, enquanto GAA indica ácido glutâmico. Logo, a resposta será letra C.

Por fim, é importante ressaltar que diversas questões com enunciado e resolução similar a esta, tem sido abordadas nos exames qualificatórios da UERJ. Até a próxima!