Arquivo da categoria ‘Exame de qualificação da UERJ’

Olá vestibulandos,

O segundo exame de qualificação da UERJ se aproxima e hoje trazemos uma lista com 10 questões de fisiologia animal retiradas diretamente de exames anteriores da universidade. Este tópico tem costume de ser abordado. Então, é sempre bom estar atentos. Bora estudar!!! Rumo ao conceito A!!!

Abaixo, temos o link com a lista das questões:

FISIOLOGIA ANIMAL

Vamos aos comentários:

1) Esta questão apresenta uma resolução simples e direta, bastando apenas observar as informações que o enunciado nos apresenta:

– As lipases são enzimas que realizam a digestão de lipídios;

– O medicamento mencionado inibe essas enzimas (as lipases), possibilitando a perda de peso;

Tendo isso em mente, devemos nos perguntar: “Em qual órgão as lipases são produzidas?”. A resposta é simples: a lipase é uma enzima presente no suco pancreático e, portanto, é produzida no pâncreas. Logo, a resposta correta é a letra C.

A tabela abaixo resume bem o processo de digestão química e auxilia na resolução da maioria das questões sobre enzimas digestivas:

digestão

2) Esta questão aborda a temática sobre ciclo menstrual e regulação por feedback. Para resolvê-la, vamos focar sobre o processo regulatório da produção de hormônios. Observe o texto abaixo:

– O hipotálamo e a hipófise apresentam importante papel no controle da produção de hormônios pelas diversas glândulas endócrinas. O primeiro é responsável por controlar a produção de hormônios pela hipófise. Esta, por sua vez, controla a produção de hormônios da tireoide, das glândulas adrenais e das gônadas (ovários e testículos). Este processo de regulação é extremamente essencial para a manutenção dos níveis hormonais adequados às diversas condições a qual o organismo é exposto e também representa uma forma do corpo responder às diversas mudanças. Geralmente, alguns hormônios hipotalâmicos (TRH, GHRH, etc) estimulam a produção e liberação de hormônios pela hipófise e esta, por sua vez, estimula a produção de hormônios na tireoide, nas adrenais e nas gônadas. Neste caso, onde os níveis de um hormônio estimulam a produção de outro, fala-se em feedback positivo, pois aumenta-se a intensidade da resposta. No entanto, níveis elevados de um determinado hormônio, podem diminuir a produção de outro, falando-se em feedback negativo. Observe a tabela abaixo, que apresenta três exemplos desse tipo de regulação:

feedback

Nos três casos, os estímulos fornecidos pelos hormônios hipotalâmicos e hipofisários representam casos de feedback positivo, pois aumentarão os efeitos gerados pelos hormônios produzidos pelas demais glândulas endócrinas. Contudo, quando os níveis dos hormônios produzidos por tireoide, adrenais e gônadas tornam-se muito elevados, os mesmos tendem a inibir (diminuir) a produção de hormônios pela hipófise ou mesmo pelo hipotálamo; nesse caso, fala-se em feedback negativo. Ambos os mecanismos tendem a favorecer a restauração da homeostase (equilíbrio corporal).

Sabendo o que foi explicado acima, podemos resolver a nossa questão. Os hormônios FSH e LH, cujos níveis estão apresentados nos gráficos, controlam a produção de progesterona e estrogênio pelos ovários. Sendo assim, se uma mulher toma anticoncepcional (que contém progesterona e estrogênio), os níveis desses dois hormônios tenderão a aumentar no sangue. Uma vez que a quantidade de progesterona e estrogênio está maior, ocorrerá inibição da liberação de FSH e LH pela hipófise, de modo que os níveis dos dois se reduzam. Sendo assim, a resposta correta é a letra C.

3) Esta questão fala sobre a regulação hormonal da função renal. Para resolvê-la, basta utilizarmos as informações presentes em seu enunciado. Algumas dessas informações são extremamente relevantes, como:

– O hormônio aldosterona aumenta a absorção de Na+ pelos túbulos renais;

– Quanto a menor a concentração de Na+ nos líquidos extracelulares, maior será a produção de aldosterona.

Sabendo disso, vamos analisar a pergunta apresentada na questão. Diz-se que um paciente foi submetido a uma rígida dieta com restrição de NaCl e pede-se pra indicar qual curva do gráfico representa a alteração nesse paciente em função dessa dieta. Inicialmente, vamos analisar a dieta: “Se a dieta impõe restrição à ingestão de NaCl, o que ocorrerá com a concentração de Na+ no organismo?”; tenderá a diminuir, visto que o paciente está ingerindo pouco sódio em sua dieta. Agora, vamos raciocinar: “Se a concentração de Na+ está diminuindo, o que ocorrerá com a produção de aldosterona?”; o próprio enunciado já nos diz que a produção desse hormônio irá aumentar. Agora, pergunto a vocês: “Se a produção de aldosterona aumenta, o corpo absorverá mais ou menos Na+?”; é claro que irá absorver maior quantidade de sódio. Contudo, a questão apresenta um problema. O gráfico apresenta a taxa de absorção de água em vez da absorção de sódio. Ora, isso é simples: se estamos reabsorvendo mais sódio, a tendência é que o corpo reabsorva maior quantidade de água, visando manter o equilíbrio osmótico e hidrossalino. Sendo assim, a curva III representa o caso desse paciente e, portanto, a resposta correta é a alternativa B.

CURIOSIDADE: vimos nesta questão que, quanto maior a reabsorção de sódio, maior a reabsorção de água. Este mesmo princípio explica a razão pela qual o sal eleva a pressão arterial. Quando ingerimos grande quantidade de sódio, o corpo tende a reabsorver mais água, elevando o débito cardíaco (volume de sangue bombeado pelo coração em um minuto), o que provoca o aumento da pressão.

4) Esta questão fala sobre o uso de pastilhas de iodeto de potássio para tratar tumores em determinada glândula endócrina. Para resolvê-la, basta recordarmos qual das glândulas mencionadas nas alternativas necessita de iodo para produzir seus hormônios. A única glândula, cujo iodo está presente em seus hormônios é a TIREOIDE. A falta desse nutriente pode provocar hipotireoidismo, que é uma insuficiência na produção de hormônios tireoidianos, que afeta o metabolismo. Sendo assim, a resposta correta é a alternativa A.

5) A resolução desta questão requer conhecimento sobre os valores de pH ideais para a ação das enzimas digestivas. Para resolvê-la, podemos usar a tabela apresentada na resolução da questão 1. Se consultarmos esta tabela, veremos que o suco duodenal apresenta valor de pH variando na faixa entre 7 e 8. Logo, suas enzimas apresentam maior atividade nessa faixa de pH. Agora, devemos analisar cada uma das curvas apresentadas e verificar em quais valores aproximados de pH, as mesmas apresentam atividade máxima. Ao fazerem isso, vocês deverão verificar:

– Curva X: a atividade enzimática máxima está na faixa de pH entre 7 e 8.

– Curva Y: a atividade enzimática é máxima em pH igual a 10.

– Curva W: a atividade enzimática é máxima por volta de pH igual a 2.

– Curva Z: a atividade enzimática é máxima em valor de pH entre 11 e 12.

Analisando cada caso, devemos nos perguntar: “Qual dessas curvas apresenta uma atividade enzimática máxima condizente com as características do suco duodenal obtidas na tabela da resolução da questão 1?”. A resposta é simples: somente a curva X representa uma enzima que atue melhor em pH na faixa entre 7 e 8. Sendo assim, a resposta correta é a alternativa B.

6) Esta questão aborda a temática sobre regulação do pH sanguíneo. Para resolvê-la, devemos relembrar que a concentração de CO2 no sangue é capaz de influenciar o pH do mesmo. Isso se deve à ocorrência da reação química abaixo apresentada:

ácido

Nesta reação, o CO2 reage com a água, formando ácido carbônico (H2CO3). Este, por sua vez, pode se ionizar e formar íons H+ e HCO3 (bicarbonato). O bicarbonato e o ácido carbônico formam um sistema-tampão do sangue, ou seja, um mecanismo que buscar impedir grandes variações no pH sanguíneo. Isto significa que, quando houver excesso de ácido no sangue, a formação de bicarbonato na segunda reação aumentará, de modo a neutralizar essa acidez. Por outro lado, se houver excesso de bases no sangue, a formação de ácido carbônico na segunda reação será favorecida e o pH voltará ao normal.

Agora que já sabemos o conceito, vamos tentar resolver a questão. No enunciado fala-se em um equipamento responsável pela remoção do CO2 de uma cápsula espacial. Após isso, diz-se que, em determinado momento, o equipamento parou de funcionar e pergunta-se o que ocorrerá com o pH sanguíneo sob estas condições. Vamos raciocinar cada situação separadamente. Primeiro, devemos nos perguntar: “Se o equipamento parar de funcionar, o que ocorrerá com a concentração de CO2 no interior da cápsula?”; a resposta é que a concentração de CO2 aumentará, visto que não está ocorrendo mais a sua remoção daquele ambiente. Em seguida, devemos nos perguntar: “Com o acúmulo de CO2 dentro da cápsula, o que ocorrerá com a concentração desse gás no sangue da tripulação?”; novamente a concentração aumentará, visto que estarão inalando maior quantidade deste gás. Por fim, devemos nos perguntar: “Se a concentração de CO2 está alta no sangue, formaremos maior ou menor quantidade de ácido carbônico?”; é claro que formaremos mais ácido carbônico.

Sabendo disso, basta deduzirmos a resposta. Concluímos que a falha no equipamento leva a uma maior produção de ácido carbônico. Se estamos aumentando a quantidade de ácido no sangue, o pH diminuirá. Logo, a resposta correta é a alternativa D.

FIQUE ATENTO!!!!

equilíbrio ácido básico

7) Esta questão aborda a temática sobre a digestão de proteínas e a quantidade do produto desse processo (os aminoácidos) em diversos compartimentos do tubo digestivo. Para resolvê-la, basta recordarmos que a digestão de proteínas ocorre em três compartimentos específicos: estômago, duodeno e jejuno-íleo. Outra informação relevante para sua resolução é que a digestão proteica se inicia no estômago, prossegue no duodeno e completa-se no jejuno-íleo.

Sabendo disso, a resolução da questão torna-se bastante simples. Uma vez que a digestão de proteínas se inicia no estômago, a quantidade de aminoácidos (produtos finais da digestão proteica) nesse órgão tende a ser menor que nos outros dois citados no enunciado. Sendo assim, o estômago é representado pela curva Y. No duodeno, a digestão de proteínas irá prosseguir e a quantidade de aminoácidos tende a aumentar; contudo, como a digestão proteica ainda está ocorrendo no duodeno, sua quantidade não será ainda a quantidade total (final) de aminoácidos obtidos na digestão de proteínas. Logo, o duodeno é representado pela curva Z. No jejuno-íleo, após todo o processo de digestão proteica ter ocorrido, estará presente toda a quantidade final de aminoácidos. Logo, este órgão é representado pela curva X. Sendo assim, a resposta correta é a letra D.

8) A resolução desta questão é bastante simples. Exige apenas o conhecimento sobre as características das principais excretas animais:

– Amônia: composto bastante solúvel em água e principal excreta de peixes ósseos e invertebrados aquáticos;

– Ureia: composto solúvel em água e principal excreta de mamíferos, peixes cartilaginosos e anfíbios adultos;

– Ácido úrico: composto pouco solúvel em água e principal excreta de répteis e aves.

Tendo em vista as informações acima apresentadas, podemos deduzir que o ser humano (que é um mamífero) é representado pelo gráfico 1, onde maior quantidade de ureia é eliminada, enquanto os répteis são representados pelo gráfico 3, visto que maior quantidade de ácido úrico é eliminado neste caso. Sendo assim, a resposta correta é a alternativa A.

9) Para resolver esta questão podemos utilizar algumas informações discutidas em um tópico anterior sobre questões de bioquímica na prova da UERJ. Em tal tópico, citei as seguintes informações:

– Sob estado bem alimentado, pouco tempo após a refeição, os níveis de um hormônio pancreático chamado de INSULINA se elevam no sangue. Este hormônio irá ativar algumas vias metabólicas, como, por exemplo, a glicólise (quebra da glicose em piruvato) e a glicogênese (síntese de glicogênio), assim como a síntese de ácidos graxos a partir de acetil-CoA e o armazenamento de triglicerídeos no tecido adiposo. Sob estado de jejum, um outro hormônio pancreático, chamado GLUCAGON, passa a controlar as diversas vias metabólicas, ativando as vias de degradação (catabolismo), como, por exemplo, a glicogenólise (quebra de glicogênio em glicose), o consumo dos triglicerídeos presentes no tecido adiposo e a oxidação dos ácidos graxos, a desaminação dos aminoácidos (que gera piruvato e intermediários presentes no ciclo de Krebs) e ativa uma via de síntese chamada de gliconeogênese (síntese de glicose, a partir de intermediários como piruvato, glicerol ou aminoácidos). Em resumo, a insulina estimula o organismo a “guardar” a glicose no fígado sob a forma de glicogênio e os ácidos graxos no tecido adiposo sob a forma de triglicerídeos. O glucagon, por sua vez, estimula o consumo das reservas energéticas (glicogênio hepático e muscular e os triglicerídeos), assim como a síntese de glicose no corpo.

 Analisando o esquema apresentado na questão e observando as informações apresentadas acima conseguiremos resolvê-la sem maiores dificuldades. Então, analisemos o que é observado no esquema:

 – Fígado: se observarem com atenção, no fígado está ocorrendo quebra do glicogênio em glicose e síntese de glicose a partir de aminoácidos. Essas características são condizentes com o estado de jejum, como mencionado no texto acima.

– Sangue: repare que a glicose está saindo do fígado e indo para o sangue, ficando acumulada no mesmo.

– Tecido adiposo: está ocorrendo quebra de triglicerídeos em ácidos graxos e glicerol. Essa condição também é comum quando temos um estado de jejum.

– Músculo: está recebendo ácidos graxos provenientes do tecido adiposo e oxidando-os até CO2 e H2O para produzir energia.

 Agora que observamos isso, analisemos cada uma das alternativas apresentadas:

– Repouso: essa condição corresponde à situação em que o suprimento de energia está alto no corpo, ou seja, o organismo está bem alimentado. Neste caso, os níveis de insulina deveriam estar elevados e os processos de síntese de glicose e quebra de glicogênio e triglicerídeos, assim como a oxidação de ácidos graxos não deveriam estar ocorrendo. Logo, o esquema não representa tal situação.

– Hiperinsulinismo: condição em que os níveis de insulina estão elevados no sangue. Nesse caso, não deveriam ocorrer a síntese de glicose, a quebra de triglicerídeos e glicogênio, assim como a oxidação de ácidos graxos. Logo, o esquema não representa tal situação.

– Dieta hiperglicídica: condição em que uma pessoa consome grande quantidade de glicídios (carboidratos) em sua alimentação. Nesta circunstância, o corpo não necessita consumir o glicogênio armazenado no fígado e nem sintetizar mais glicose. Logo, o esquema não representa esta situação.

– Diabetes melito: doença em que ocorre hiperglicemia (excesso de glicose no sangue), como observado no esquema. Em função da falta de insulina, a glicose não é levada para o interior das células, de modo que o corpo passa a consumir suas reservas energéticas, como, por exemplo, os triglicerídeos e o glicogênio, assim como sintetizar glicose e oxidar ácidos graxos. Todos esses efeitos são observados no esquema.

Sendo assim, a resposta correta é a letra B.

10) Esta questão fala sobre as junções neuromusculares. Para resolvê-la, devemos lembrar de algumas informações:

– A contração muscular depende de estímulos fornecidos por uma terminação nervosa. Esse estímulo é gerado por substâncias, chamadas de neurotransmissores, que são liberadas pelos neurônios e que atuam sobre receptores presentes no músculo. Uma dessas substâncias com papel de induzir a contração muscular é a acetilcolina.

– O processo de contração muscular envolve alguns eventos. Inicialmente, mediante o estímulo do neurotransmissor (por exemplo, acetilcolina), o cálcio presente no retículo sarcoplasmático é liberado, ocupando o citosol (citoplasma) da fibra muscular. Esse processo desencadeia a contração muscular.

Tendo em vista as informações acima, podemos resolver a questão sem maiores dificuldades. Repare que no enunciado diz-se que o aldicarb (chumbinho) inibe uma enzima chamada acetilcolinesterase, que é responsável pela degradação da acetilcolina e pergunta-se qual gráfico representará a concentração de cálcio no retículo sarcoplasmático e no citosol do músculo de uma pessoa que tenha ingerido essa substância.

Vamos raciocinar com calma. O aldicarb inibe a acetilcolinesterase; qual será o efeito desta inibição? A resposta é simples: se a acetilcolinesterase degrada a acetilcolina e está inibida, não haverá degradação de acetilcolina e a mesma se acumulará na junção neuromuscular. Agora, vamos nos perguntar: “Se temos acúmulo de acetilcolina, o que ocorrerá com o cálcio?”; vimos acima que, mediante o estímulo da acetilcolina, o cálcio sai do retículo e vai para o citosol. Sabendo disso, o que ocorrerá com a quantidade de cálcio no retículo e no citosol? A resposta é simples: a quantidade de cálcio diminuirá no retículo e aumentará no citosol. Sendo assim, vemos que apenas o gráfico II representa tal situação. Logo, a resposta correta é a alternativa B.

Anúncios

Hoje trazemos os comentários de 12 questões de bioquímica abordadas nos diversos exames de qualificação da UERJ. O link abaixo apresenta as questões:

aulão1

Agora, vamos aos comentários:

1) Para resolver esta questão precisamos relembrar o conceito geral de síntese de proteínas:

“Processo dividido em duas etapas. A primeira é chamada de transcrição e envolve a formação de uma molécula de RNA a partir de uma sequência de DNA. Em seguida, ocorre à tradução, processo em que a molécula de RNA é lida e formará uma molécula de proteína.”

Agora, devemos analisar as informações apresentadas no gráfico. Repare que, neste caso, o gráfico indica a quantidade de proteínas formadas em ovos fertilizados e não-fertilizados de ouriço do mar mediante a marcação com um elemento radioativo (14C). Então, pergunto a vocês: quais diferenças são observadas ao comparar ovos não-fertilizados com fertilizados? Se vocês observarem atentamente o gráfico, irão ver que a quantidade de proteínas é muito maior em ovos fertilizados do que nos não-fertilizados. Então, realizou-se uma experiência. Nela, adicionou-se um antibiótico (actinomicina D) ao meio que continham ovos fertilizados e determinou-se a quantidade de proteínas formadas. O enunciado informa também que este antibiótico inibe a transcrição, ou seja, impede a formação de RNAm a partir de DNA. Então, pergunto a vocês: a presença do antibiótico afetou a formação de proteínas nos ovos fertilizados? Se analisarem atentamente o gráfico, irão verificar que a quantidade de proteínas permaneceu praticamente igual aos ovos fertilizados que não receberam antibiótico.
Agora, vamos analisar as alternativas:

a) Observamos que a quantidade de proteínas aumentou significativamente após a fertilização dos ovos. Contudo, isso não indica que a estabilidade das mesmas tenha aumentado. ALTERNATIVA INCORRETA!

b) A tradução é a formação de proteínas a partir do RNA. No item, diz-se que a tradução seria a formação de RNA a partir de DNA, ou seja, o item apresenta uma afirmativa errada, ALTERNATIVA INCORRETA!

c) A transcrição é a formação de RNA a partir de uma sequência de DNA e não a conversão do RNA em proteínas. ALTERNATIVA INCORRETA!

d) Repare que o enunciado diz que o antibiótico inibe a transcrição, ou seja, diminui a formação de RNAm. Como o RNAm será traduzido em proteína posteriormente, quanto maior a taxa de transcrição maior a quantidade de proteínas. Logo, se o antibiótico houvesse bloqueado a transcrição, esperávamos que a quantidade de proteínas nos ovos fertilizados tratados com antibiótico fosse diminuir, o que não ocorreu. Sendo assim, isso indica que a transcrição já havia ocorrido antes da adição do antibiótico. ALTERNATIVA CORRETA!

 

2) Essa questão trata de um método aplicado em laboratórios de pesquisa conhecido como ELETROFORESE EM GEL. Caso tenham interesse em compreender o método, o vídeo abaixo apresenta uma ilustração bastante didática e, embora esteja em inglês, apresenta legenda:

http://www.youtube.com/watch?v=TZ-K13Y4ffw

Mas para resolvê-la não é necessário conhecermos o procedimento. Basta compreendermos três pontos essenciais:

– As proteínas podem apresentar carga positiva, negativa ou nula em função do pH do meio onde se encontram. Geralmente, em pH ácido apresentam carga negativa e em pH básico apresentam carga positiva.

– O ponto isoelétrico (pI) de uma proteína representa o pH em que a mesma apresenta carga nula.

– Quanto maior a diferença entre o pI da proteína e o pH do meio, maior será sua carga.

Os três tópicos acima são apresentados no enunciado e bastam para que possamos resolver esta questão. A primeira informação que vamos aplicar é o fato da diferença o pI e o pH indicarem qual proteína possui maior ou menor carga. No enunciado, apresentam-se quatro proteínas e diz-se que o pH do meio é igual a 6,0. A primeira proteína tem pI igual a 8,0; logo, a diferença para o pH do meio é igual a 2. A segunda proteína tem pI igual a 7,6; logo, a diferença para o pH é igual a 1,6. A terceira proteína tem pI igual a 6,6; logo, a diferença para o pH é igual a 0,6. Por fim, a quarta proteína possui pI igual a 4,8 e diferença de 1,2 para o pH do meio. Sabendo essas diferenças, podemos ordenar as proteínas em função de suas cargas.
LEMBRE-SE!!! Quanto maior a diferença, maior a carga da proteína. Então, como ficaria a ordem crescente de proteínas em função de suas cargas? O correto seria:

Alfaglobulina < Albumina < Betaglobulina < Gamaglobulina

No entanto, na pergunta, questiona-se qual a ordem crescente de velocidade de migração. Basta lembrarmos o seguinte:

“Quanto maior a carga, maior a velocidade de migração da proteína!”

Sendo assim, a proteína que apresentar menor carga, terá menor velocidade de migração e vice-versa. Desse modo, a ordem crescente das velocidades é igual a ordem crescente das cargas das proteínas. Logo, a resposta correta seria a letra D.

 

3) Este enunciado aborda a temática do controle de pH sanguíneo e dos sistemas-tampão do sangue.
O sangue apresenta como principal mecanismo de controle do pH, um sistema-tampão chamado de bicarbonato/ácido carbônico (HCO3-/H2CO3). Neste caso, o CO2 presente no sangue reage com a água, formando ácido carbônico, que se ioniza e forma íons H+ e HCO3- (bicarbonato), como representado na reação apresentada no enunciado. Sendo assim, a concentração de CO2 no sangue irá influenciar indiretamente no valor do pH. Raciocinemos da seguinte forma:

“Se aumentarmos a concentração de CO2 no sangue, o que ocorrerá com a quantidade de H+ formado? Também aumentará. Sendo assim, um aumento no CO2 no sangue, aumenta a concentração de H+.”

Agora, analisemos a situação apresentada. No enunciado da questão, fala-se que o pH sanguíneo é controlado pelo ritmo respiratório e menciona-se uma condição chamada de HIPERVENTILAÇÃO, perguntando o que ocorrerá com a concentração de H+ e com o pH quando estamos nessa condição. Para auxiliar-nos, o enunciado apresenta uma tabela, em que quatro combinações distintas de concentração de H+ e de pH são apresentadas como alternativas. Se vocês tiverem atenção, observarão que duas das condições apresentadas não podem ser corretas: I e IV. Lembre-se que a concentração de H+ é inversa ao pH; quanto maior a concentração de H+, menor será o pH e vice-versa. Sendo assim, a concentração de H+ e o pH não podem estar altos ao mesmo tempo, nem baixos ao mesmo tempo.
Agora, vamos avaliar a situação apresentada na questão. Sob hiperventilação, o que irá ocorrer com a concentração de CO2 no sangue? No próprio enunciado, diz-se que aumenta a eliminação de CO2 pela expiração. Sendo assim, a concentração de CO2 irá diminuir no sangue, provocando uma redução na concentração de H+. Logo, a concentração de H+ fica baixa e o pH fica mais alto. Desse modo, a resposta correta é a letra C.

 

4) Esta questão aborda a temática do metabolismo energético muscular. Para auxiliar na resolução, duas informações são apresentadas no enunciado: uma tabela e um esquema do metabolismo energético. A tabela indica três tipos de corridas (100, 400 e 800 m) e o percentual de energia obtida por fonte aeróbia e anaeróbia em cada uma dessas corridas.
Para resolvê-la, basta recordarmos sobre as fontes aeróbias e anaeróbias de produção de energia. O metabolismo de carboidratos se inicia com a glicólise (quebra de glicose, formando duas moléculas de piruvato). Uma vez que ocorreu a glicólise, o piruvato pode seguir caminhos distintos:

– Na presença de O2: o piruvato é convertido em acetil-CoA e participa do ciclo de Krebs e da fosforilação oxidativa. Este processo caracteriza a RESPIRAÇÃO CELULAR.

– Na ausência de O2: o piruvato é convertido em lactato, caracterizando a FERMENTAÇÃO LÁCTICA.

Agora, vamos avaliar a pergunta apresentada: “Ao final da corrida de 400 m, a maior parte da energia despendida é oriunda da atividade metabólica ocorrida em quais etapas?”. Ao analisarmos a tabela, vemos que 70% da energia obtida pelo recordista na corrida de 400 m é de fonte anaeróbia. Sabendo disso, podemos deduzir que a energia provém da fermentação láctica. Baseado no conceito apresentado acima, sabemos que a fermentação envolve a conversão de piruvato a lactato. Desse modo, a alternativa correta é a letra A.

 

5) A questão abaixo apresenta um esquema de diversas etapas do metabolismo de carboidratos nos seres vivos. Se analisarmos o esquema atentamente, veremos que ocorre a síntese e degradação de uma série de carboidratos (celulose, glicogênio, amido e glicose). Então, pergunta-se quais dessas etapas ocorrem nos consumidores primários. Para resolvê-la, devemos analisar os diversos pares de etapas.
Inicialmente, vamos analisar as etapas 1 e 2. A etapa 1 representa a conversão de CO2 e H2O em glicose (C6H12O6), enquanto a etapa 2 representa a conversão de glicose, formando CO2 e água. Então, devemos nos perguntar: “Qual processo absorve gás carbônico e água e forma glicose? E qual processo envolve a quebra de glicose, formando gás carbônico e água?”.
A resposta é extremamente simples: o processo 1 representa a fotossíntese e o processo 2 é a respiração celular. Lembrem-se das equações gerais desses dois processos:

Fotossíntese: 6 CO2 + 12 H2O → C6H12O6 + 6 O2 + 6 H2O

Respiração Celular: C6H12O6 + 6 O2 → 6 CO2 + 6 H2O

Agora, devemos nos perguntar qual(is) desse(s) processo(s) são realizados pelos consumidores primários. Se é um consumidor, significa que ele se alimenta de outros seres vivos, ou seja, é um organismo heterótrofo. Sendo assim, podemos deduzir que eles não realizam a fotossíntese. Desse modo, as alternativas A e B estão incorretas. Contudo, todos os seres vivos, sem exceção, realizam a respiração celular (inclusive os consumidores). Sendo assim, a alternativa B é a resposta correta. Repare! Sabendo esta única informação, você consegue resolver a questão.

cadeias

 

 

6) O esquema abaixo pode auxiliar na resolução da questão, visto que apresenta uma representação geral de diversas etapas metabólicas que ocorrem no fígado, como, por exemplo, síntese e degradação de glicogênio e de glicose, oxidação de ácidos graxos e desaminação dos aminoácidos. Os processos de síntese caracterizam o ANABOLISMO, enquanto as reações de degradação envolvem o CATABOLISMO.

metabolismo fígado

Agora, devemos considerar que a ocorrência das etapas representadas no esquema acima irá variar em função da condição metabólica. Em termos gerais, o organismo possui dois estados metabólicos: jejum e bem alimentado.

Sob estado bem alimentado, pouco tempo após a refeição, os níveis de um hormônio pancreático chamado de INSULINA se elevam no sangue. Este hormônio irá ativar algumas vias metabólicas, como, por exemplo, a glicólise (quebra da glicose em piruvato) e a glicogênese (síntese de glicogênio), assim como a síntese de ácidos graxos a partir de acetil-CoA e o armazenamento de triglicerídeos no tecido adiposo.

Sob estado de jejum, um outro hormônio pancreático, chamado GLUCAGON, passa a controlar as diversas vias metabólicas, ativando as vias de degradação (catabolismo), como, por exemplo, a glicogenólise (quebra de glicogênio em glicose), o consumo dos triglicerídeos presentes no tecido adiposo e a oxidação dos ácidos graxos, a desaminação dos aminoácidos (que gera piruvato e intermediários presentes no ciclo de Krebs) e ativa uma via de síntese chamada de gliconeogênese (síntese de glicose, a partir de intermediários como piruvato, glicerol ou aminoácidos).  

Em resumo, a insulina estimula o organismo a “guardar” a glicose no fígado sob a forma de glicogênio e os ácidos graxos no tecido adiposo sob a forma de triglicerídeos. O glucagon, por sua vez, estimula o consumo das reservas energéticas (glicogênio hepático e muscular e os triglicerídeos), assim como a síntese de glicose no corpo.

Considerando estas informações, podemos responder à pergunta apresentada na questão. Repare que é perguntado quais etapas são ativadas após uma pessoa se manter por jejum por 24h. Já sabemos que o jejum estimula a glicogenólise, a oxidação dos ácidos graxos, a desaminação dos aminoácidos e a gliconeogênese. Sabendo disso, podemos deduzir que esses quatro processos metabólicos, representados pelos itens 1, 3, 5 e 6, estarão ocorrendo mais intensamente. Sendo assim, o gráfico X representa esta condição e a resposta correta é a letra B.

 

7) Esta questão aborda os conceitos gerais de respiração celular e fermentação láctica. Para resolvê-la, precisamos recordar brevemente estes dois processos:

 – A respiração celular aeróbia é um processo dividido em três etapas glicólise (quebra de glicose em piruvato), ciclo de Krebs e cadeia respiratória (ou transportadora de elétrons). A primeira etapa é anaeróbia, ou seja, ocorre na ausência de O2. Contudo, a ocorrência do ciclo de Krebs e da cadeia respiratória (etapas mitocondriais) irá depender da disponibilidade de oxigênio, visto que o mesmo atua como aceptor final de elétrons na cadeia respiratória.

 – A fermentação láctica é uma via alternativa de reoxidação do NADH (o NAD é necessário para a continuidade da glicólise), que ocorre em condições anaeróbias, convertendo o piruvato em lactato.

 No enunciado da questão, diz-se que foi adicionado um inibidor da cadeia respiratória e pergunta-se qual o ácido deverá acumular-se nesta condição. Vamos raciocinar juntos! Na presença de um inibidor de cadeia respiratória, esta etapa estará bloqueada. Como uma de suas funções envolve a reoxidação do NADH (transformá-lo novamente em NAD, para que possa ser reutilizado), alguém deverá substituir a cadeia respiratória neste processo. Sendo assim, na presença deste inibidor, o NADH será reoxidado pelo processo de fermentação láctica, promovendo o acúmulo de ácido láctico ou lactato. Desse modo, a resposta correta é a alternativa A.

nad

 

 

8) Esta questão aborda um tema relacionado com a química, que é o conceito de meia-vida, relacionado com a temática de radioatividade. Para resolvê-la, temos que relembrar o conceito de meia-vida:

 “Tempo necessário para que a quantidade de determinado material radioativo se reduza à metade.”

 Sabendo disso, podemos interpretar e resolver a questão. Ao analisar a tabela, podemos verificar que a radioatividade aumenta ao longo do tempo para as quatro proteínas estudadas (W, X, Y e Z). Contudo, a partir de 8 minutos, a radioatividade começa a diminuir. Para estimarmos a meia-vida dessas quatro proteínas marcadas deveremos observar a queda de radioatividade para cada uma das proteínas:

 – Proteína W: a radioatividade cai de 28 para 27 e depois para 26, ou seja, a cada dois minutos, a radioatividade cai uma unidade.

– Proteína X: a radioatividade cai de 25 para 23 e depois para 21, ou seja, a cada dois minutos, a radioatividade cai duas unidades.

– Proteína Y: a radioatividade cai de 24 para 21 e depois para 18, ou seja, a cada dois minutos, a radioatividade cai três unidades.

– Proteína Z: a radioatividade cai de 20 para 16 e depois para 11, ou seja, a cada dois minutos, a radioatividade cai em média 4,5 unidades.

 Agora, pergunto a vocês: “Considerando as informações acima, a meia-vida será menor para qual proteína?”. Basta relembrarmos o conceito de meia-vida e podemos deduzir que aquela proteína que decai mais rapidamente será aquela que possui menor meia-vida (menor tempo de decaimento). Sendo assim, a proteína de menor meia-vida é a Z. Logo, a resposta correta é a alternativa D.

 

9) Já vimos na questão 6 apresentada acima que, sob condição de jejum, o fígado realiza gliconeogênese, que é a síntese de glicose a partir de outras moléculas, como, por exemplo, piruvato, glicerol e aminoácidos. Dentre as moléculas mencionadas, somente uma está apresentada nas alternativas, que são os aminoácidos. Sendo assim, a resposta correta é a letra C.

 

10) Esta questão aborda os processos de fermentação. O enunciado apresenta um esquema do processo de fermentação láctica, indicando a conversão de piruvato a lactato. Então, pergunta-se qual o produto da fermentação realizada pela levedura utilizada na fabricação de cerveja. A levedura é um fungo que realiza fermentação alcoólica, processo em que o piruvato é convertido a etanol e gás carbônico.

Sabendo disso, podemos deduzir que a resposta correta é a alternativa A.

 

11) Esta questão aborda o tema proteínas. No enunciado, apresenta-se um gráfico, que indica a carga de quatro proteínas em função do pH do meio. Para resolver este item, precisamos ter atenção a uma informação apresentada:

 A molécula do DNA, em pH fisiológico, apresenta carga elétrica negativa, devido a sua natureza ácida. No núcleo celular, ela está associada a proteínas, de caráter básico, denominadas histonas.”

 Esta única informação ajuda-nos a solucionar a questão. Repare que diz-se que o DNA apresenta carga negativa em pH fisiológico. Qual é o pH fisiológico? É o pH mais comum dos fluidos corporais e seu valor é aproximadamente 7,4.

Agora, devemos avaliar outro ponto: diz-se que o DNA está associado a proteínas, de caráter básico, chamadas de HISTONAS. Então, pergunta-se qual das curvas do gráfico pode representar uma histona. Para resolver isso, basta lembrar-nos da lei de atração e repulsão, que diz que cargas opostas se atraem e cargas iguais se repelem. Então, pergunto a vocês: “Sabendo que o DNA possui carga negativa em pH fisiológico e tendo conhecimento da lei de atração e repulsão, qual deverá ser a carga das histonas, em pH fisiológico, para que possam interagir com o DNA?”. A resposta é simples: se o DNA possui carga negativa, só poderá interagir com proteínas que, em pH fisiológico, possuam carga positiva.

Então, analisemos o gráfico: somente a proteína W apresenta carga positiva em pH 7,4.  Sendo assim, a resposta correta é a alternativa A.

 

12) O enunciado da questão fala sobre os efeitos de uma droga, a aloxana, que destrói as células β das ilhotas pancreáticas. Além disso, apresenta quatro gráficos que representam a variação de três parâmetros distintos: taxa de glicose no sangue e na urina e taxa de glicogênio hepático. Por fim, pergunta-se qual gráfico representa os animais que foram previamente tratados com aloxana.

Para resolver esta questão, devemos nos perguntar qual a função das células β do pâncreas. A resposta é simples: estas células são responsáveis pela produção de insulina, um hormônio que controla o metabolismo. O principal efeito da insulina é o controle da glicemia (taxa de glicose no sangue). Esse hormônio remove a glicose do sangue e guarda-a nas células hepáticas e musculares sob a forma de glicogênio, de modo que reduz a glicemia.

Sabendo dos efeitos acima mencionados, podemos resolver a questão. Raciocinemos! A aloxana destrói as células β do pâncreas, de modo a provocar uma intensa redução na produção de insulina. Se os níveis de insulina diminuem no sangue, menor quantidade de glicose será removida, promovendo um aumento na glicemia (taxa de glicose no sangue). Sabendo disso, somente os gráficos W e Y podem estar corretos. Se pouca glicose está sendo retirada do sangue, isso implica que menor quantidade de glicogênio será formada no fígado; logo, a taxa de glicogênio hepático tenderá a diminuir. Sabendo disso, já podemos deduzir que o gráfico Y representa o animal tratado com aloxana. Então, deduzimos que a taxa de glicose na urina aumenta; isso se deve ao excesso de glicose no sangue é característico de pacientes diabéticos.

Desse modo, a resposta correta é a alternativa C.

Vamos lá galerinha!!!

O primeiro exame de qualificação da UERJ já passou e agora temos que nos preparar para o segundo exame de qualificação, que será em Setembro. Hoje trago o comentário das questões de Biologia presentes na prova de domingo passado, com direito a um comentário detalhado da questão 41, que deixou muitos alunos confusos com seu enunciado. Felizmente, a questão foi anulada pela universidade. Vamos estudar!

 

30) Esta questão requer conhecimento sobre o processo evolutivo das plantas terrestres. Para resolvê-la, basta termos conhecimento sobre as principais características dos quatro grupos de vegetais.

– Briófitas: são os vegetais mais simples encontrados em ambiente terrestre e caracterizam-se por serem avasculares (não possuem vasos condutores de seiva) e por viverem em ambientes úmidos. Além disso, sua reprodução é dependente de água. Os principais exemplos desse grupo são os musgos, hepáticas e antóceros;

– Pteridófitas: são vegetais vasculares (possuem vasos condutores de seiva) e reprodução dependente de água. As samambaias e avencas são os principais representantes deste grupo;

– Gimnospermas: são vegetais vasculares e possuem sementes e reprodução independente de água. Os pinheiros, encontrados na mata de araucárias, são os principais representantes deste grupo;

– Angiospermas: são vegetais vasculares, que possuem sementes e frutos e reprodução independente de água. As árvores frutíferas são os principais representantes deste grupo.

Tendo em vista as informações acima, podemos dizer que pteridófitas, gimnospermas e angiospermas formam um grupo de vegetais chamados vegetais vasculares, pois possuem tecidos condutores de seiva. Além disso, gimnospermas e angiospermas, formam um grupo chamado de fanerógamas, pois possuem sementes e reprodução independente de água.

Sabendo disso, podemos analisar o cladograma. A característica A está presente em todos os grupos de vegetais terrestres. A característica B está presente somente em pteridófitas, gimnospermas e angiospermas. A característica C, por sua vez, está presente somente em gimnospermas e angiospermas. Sabendo disso, podemos deduzir que as características B e C são, respectivamente, a presença de tecidos vasculares e a presença de sementes. Ao analisarmos as alternativas, vemos que só o item D apresenta tal resposta e, portanto, é a resposta correta.

 

31) Esta questão poderia ser resolvida do ponto de vista da química ou da biologia. O enunciado fala sobre a queima de combustíveis fósseis e seus impactos sobre a intensidade do efeito estufa e pergunta-se qual óxido ácido seria o principal responsável por esse processo. Do ponto de vista da biologia, basta lembrar que o CO2 é o principal gás responsável pelo aquecimento do planeta. Do ponto de vista da química, basta lembrar que o processo de combustão completo produz, geralmente, gás carbônico e água.

 

35) Esta questão aborda o tópico sobre osmorregulação em peixes. Para resolvê-la, vamos compreender a situação apresentada na questão. O enunciado fala sobre espécies de peixes que vivem em água doce, mas que conseguem sobreviver mesmo em condições nas quais a salinidade está mais elevada. Analisemos como estará a concentração de sais em um peixe de água doce:

“Em água doce, a concentração de sais é relativamente baixa, de modo que os peixes que vivem nesse ambiente apresentam maior concentração de sais no interior das suas células, ou seja, o meio da água doce é hipotônico (menos concentrado) em relação ao interior das células dos peixes.”

Se a concentração de sais é maior no interior das células, a tendência é que haja entrada de água nas células do peixe, provocando um aumento no volume celular. Para compensar essa entrada excessiva de água, os peixes de água doce tendem a formar grande quantidade de urina, para eliminar esse excesso de água.

Agora vamos analisar a situação apresentada na questão: diz-se que um rio sofreu um processo de salinização, ou seja, houve aumento na concentração de sais e que o peixe responde eliminando mais urina e reabsorvendo mais sais. Se o animal está eliminando mais urina, ele estará eliminando mais água. Com isso, podemos dizer que, por eliminar mais água, o animal estará em um meio com concentração mais elevada. Ao analisarmos as alternativas, vemos que o trecho Y é aquele que apresenta maior concentração de sais e também não está muito distante da concentração original. Logo, a resposta correta é o item C.

  

37) Esta questão poderia ser resolvida tanto pela química quanto pela biologia. No enunciado, fala-se sobre um tipo de interação química que é responsável pelo pareamento de bases no DNA. Com essa informação, devemos nos perguntar qual tipo de interação química é responsável pela união da dupla fita de DNA. A resposta é simples: PONTES DE HIDROGÊNIO. Do ponto de vista da química, bastava lembrarmos que as moléculas de água encontram-se altamente coesas e unidas por conta das pontes de hidrogênio formadas entre elas. Logo, a resposta correta é a letra C.

 

39) O enunciado desta questão fala sobre a presença de membranas interdigitais em embriões de alguns vertebrados. Uma membrana interdigital é um pedaço de tecido localizado entre os dedos, que é observado em algumas espécies adultas, como, por exemplo, em anfíbios aquáticos e algumas aves. No enunciado, diz-se que, em determinado momento do desenvolvimento, o citoplasma da célula libera enzimas que digerem essas membranas. Essa informação é crucial para a resolução da questão. Repare que ele fala em enzimas e digestão. Somente uma organela citoplasmática possui função de digestão intracelular e é conhecida como LISOSSOMO. Logo, a resposta correta é a letra A.

 

41) Esta questão apresenta um tópico que a UERJ tradicionalmente em suas provas, que é a ocorrência de mutações e as possíveis alterações na sequência de aminoácidos de uma proteína. Comentei sobre isso no facebook do blog e também apresentei resoluções de algumas questões sobre tal assunto anteriormente.

O enunciado fala sobre a ocorrência de mutações no RNAm (RNA mensageiro).Lembre-se que mutações são alterações que ocorrem na sequência de DNA e que, consequentemente, podem alterar a o RNAm (produzido a partir de sequências de DNA). Isso seria um erro conceitual da questão.

Ainda no enunciado, diz-se que podem ocorrer substituições simultâneas de bases nitrogenadas adjacentes. Uma substituição é a troca de um nucleotídeo contendo uma dada base nitrogenada por outro nucleotídeo contendo uma base diferente. Sendo assim, a substituição não altera a quantidade de nucleotídeos presentes na sequência de RNAm mensageiro. Essa informação é de grande valia!

Então, pergunta-se qual alternativa apresenta o número de substituições que irá provocar maior alteração na estrutura da proteína formada.

Para alterar a proteína formada, é necessário que haja alteração na sequência de seus aminoácidos, que é determinada pela sequência do RNA mensageiro. Lembre-se que cada trinca de nucleotídeos (cada trinca de letras) do RNAm é chamada de códon e cada uma delas indica um aminoácido específico.

Para compreendermos essa questão e possamos analisá-la, vamos usar uma sequência aleatória:

 

AUGGCCCCAUUUGUGGCAUAG

 

Tendo em vista as informações acima, analisemos cada alternativa:

 

1) Letra A: diz que ocorrem 3 substituições. Se houvessem substituições em três bases adjacentes (que estão uma ao lado da outra), haveriam as seguintes possibilidades:

 – Troca de uma trinca inteira, como mostrado abaixo:

 Sequência normal: AUGGCCCCAUUUGUGGCAUAG

Sequência alterada: AUGCAACCAUUUGUGGCAUAG

Repare que trocamos um códon inteiro. Então, se trocamos um códon, poderíamos trocar um aminoácido.

 

– Troca de dois nucleotídeos numa trinca e um nucleotídeo em outra trinca, como mostrado abaixo:

Normal: AUGGCCCCAUUUGUGGCAUAG

Alterada: AUGGCCCCAUGGCUGGCAUAG

Repare que trocamos duas bases na trinca UUU, que passou a ser UGG. E trocamos uma base na trinca GUG, que passou a ser CUG. Neste caso, poderíamos trocar até dois aminoácidos.

 

2) Letra B: diz que ocorre 4 substituições. Neste caso, teríamos duas possibilidades:

– Troca de uma trinca inteira e mais uma base em outra trinca, como mostrado abaixo:

Normal: AUGGCCCCAUUUGUGGCAUAG

Alterada: AUGCAAGCAUUUGUGGCAUAG

Repare que aqui podemos trocar uma trinca inteira (GCC por CAA) e mais uma base de outra trinca (CCA por GCA). Neste caso, estamos alterando até dois códons e, portanto, poderíamos modificar dois aminoácidos.

 

-Troca de duas bases em um códon e outras duas bases em outro códon:

Normal: AUGGCCCCAUUUGUGGCAUAG

Alterada: AUGGGGGGAUUUGUGGCAUAG 

Repare que aqui poderia estar trocando GCC por GGG (mudei duas bases C por G) e CCA por GGA (mudei duas bases C por G). Neste caso, estou alterando dois códons e, portanto, poderia mudar dois aminoácidos.

 

3) Letra C: diz-se que ocorre 6 substituições nas bases adjacentes. Com isso, teríamos as seguintes possibilidades:

– Troca de dois códons inteiros, como mostrado abaixo:

Normal: AUGGCCCCAUUUGUGGCAUAG

Alterada: AUGCCAGGUUUUGUGGCAUAG

Repare que aqui estamos modificando duas trincas inteiras. Sendo assim, estaríamos modificando dois aminoácidos.

 

– Troca de duas bases em uma trinca, três bases em outra trinca e uma base em outra trinca, como mostrado abaixo:

Normal: AUGGCCCCAUUUGUGGCAUAG

Alterada: AUGGCCCGUAAACUGGCAUAG

Repare que modificamos duas bases na trinca CCA, que passou a ser CGU. Depois modificamos toda a trinca UUU, que passou a ser AAA. Por fim, modificamos uma base na terceira trinca, que de GUG passou a ser CUG. Se alteramos três trincas, poderíamos alterar três aminoácidos.

 

4) Letra D: diz que houve 9 substituições. Neste caso, teríamos as seguintes possibilidades:

– Mudança de três códons inteiros, como mostrado abaixo:

Normal: AUGGCCCCAUUUGUGGCAUAG

Alterada: AUGCAAGGUAAAGUGGCAUAG

Repare que modificamos três códons inteiros: GCC por CAA, CCA por GGU e UUU por AAA. Neste caso, como mudamos três códons, poderíamos ter alteração de três aminoácidos.

 

– Mudança de duas bases em um códon, dois códons inteiros e uma base em outro códon:

Normal: AUGGCCCCAUUUGUGGCAUAG

Alterada: AUGGGGGGUAAACUGGCAUAG

Repare que mudamos duas bases na primeira trinca (GCC para GGG). Em seguida, mudamos dois códons inteiros (CCA por GGU e UUU por AAA) e, por fim, mudamos a primeira base de um códon (GUG por CUG). Neste caso, alteramos quatro códons e, portanto, podemos alterar quatro aminoácidos.

Essa seria a lógica de resolução desta questão, considerando a ocorrência de substituições e que sempre ocorreria mudança nos aminoácidos. Sendo assim, a resposta correta seria letra D. Contudo, repare que disse que necessitaríamos considerar que sempre haveria troca do aminoácido. Porque falei isso? O código genético é degenerado, ou seja, um mesmo aminoácido pode ser codificado por várias trincas (códons), de modo que podem ocorrer mudanças na sequência que não alteram o aminoácido. Essa seria outra razão que dificulta a resolução da questão.

Em função dessas dificuldades, a universidade optou por anular esta questão. Analisando-a com calma, acredito que a intenção da universidade era abordar um tipo específico de alteração no DNA, que envolve os processos de inserção e deleção.

A inserção ou a deleção de um único nucleotídeo é capaz de provocar uma alteração completa na sequência de códons no RNAm. Observe abaixo: 

– Inserção de um nucleotídeo:

Normal: AUGGCCCCAUUUGUGGCAUAG

Alterada: AUGUGCCCCAUUUGUGGCAUAG

Repare que coloquei uma base U logo depois do códon AUG. Essa única inserção modificará toda a sequência de códons. Na sequência normal, os códons seriam: AUG, GCC, CCA, UUU, GUG, GCA e UAG. Na sequência alterada, os códons seriam: AUG, UGC, CCC, AUU, UGU, GGC e AUA. Sendo assim, poderíamos estar alterando todos os aminoácidos que vem depois da mutação.

 

– Deleção de um nucleotídeo:

Normal: AUGGCCCCAUUUGUGGCAUAG

Alterada: AGGCCCCAUUUGUGGCAUAG

Repare que deletei a base U presente no códon AUG. Essa deleção alterará toda a ordem dos códons nessa sequência. A sequência normal tinha os códons: AUG, GCC, CCA, UUU, GUG, GCA e UAG. A sequência alterada apresentará os códons: AGG, CCC, CAU, UUG, UGG e CAU.

Hoje vamos apresentar a resolução de mais um exame qualificatório da UERJ (o segundo exame de 2003). O link da prova pode ser encontrado abaixo:

http://www.vestibular.uerj.br/portal_vestibular_uerj/arquivos/arquivos2003/2003eq2_2de3.pdf

 

RESOLUÇÃO COMENTADA

23) Esta questão aborda a fisiologia vegetal, discutindo os fatores que influenciam o processo de fotossíntese e o crescimento de plantas.

Neste caso, realizou-se uma experiência em que quatro plantas distintas foram mantidas sob concentrações constantes de CO2 e O2 e umidade e temperatura constantes. Contudo, o tempo de iluminação foi variável para cada planta. Após isso, os vasos contendo cada planta foram colocados em um prato de uma balança, equilibrada com o mesmo peso P0. Após alguns dias, os vasos foram equilibrados com pesos distintos de modo que P3>P2>P1>P4. Então, pergunta-se qual vaso foi submetido a um período de iluminação de 6h.

Para resolver esta questão, precisamos recordar sobre como a taxa de iluminação afeta a fotossíntese:

“O aumento na taxa de iluminação provoca a elevação da taxa fotossintética, ou seja, sob taxa de iluminação mais alta, a produção de matéria orgânica pelas plantas aumenta.”

Contudo, existe um ponto chamado de SATURAÇÃO LUMINOSA, em que, mesmo que ocorra aumento da intensidade luminosa, a taxa fotossintética se manterá constante.

A partir deste conceito, podemos deduzir que, quanto maior o tempo de exposição à luz, maior será a taxa de fotossíntese e, consequentemente, maior será o peso da planta estudada. Sendo assim, a planta que apresentou peso P3 foi aquela exposta ao maior período de luz (12h), enquanto a que apresentou menor peso (P4) foi a que esteve exposta ao menor período de luz (3h). Usando este raciocínio, podemos deduzir que a planta com o peso P2 foi exposta à luz por 9h e a planta com peso P1 foi exposta à luz por 6h.

Desse modo, a resposta correta é a letra A.

 

26) Esta questão envolve conhecimento sobre as principais funções celulares. A questão apresenta uma figura que representa as diversas estruturas celulares. Na pergunta, questiona-se quais dessas estruturas estão relacionadas às seguintes funções celulares: glicólise, síntese de RNA, parte aeróbica da respiração celular e o transporte ativo de íons sódio e potássio.

Para resolvê-la, vamos discutir cada função mencionada:

– Glicólise: processo de quebra de glicose, que ocorre em condições anaeróbias (ausência de oxigênio) e no citoplasma (citosol). Sendo assim, esta função está relacionada com a estrutura 8.

Essa simples observação, já permite deduzir que a resposta correta é a letra A.

– Síntese de RNA: é um processo de produção de RNA a partir da molécula de DNA, que ocorre no núcleo da célula. Sendo assim, esta função está relacionada com a estrutura 5.

– Parte aeróbica da respiração: processo que engloba o ciclo de Krebs e a fosforilação oxidativa, que ocorre no interior das mitocôndrias. Sendo assim, esta função relaciona-se com a estrutura 3.

– Transporte ativo de íons sódio e potássio: processo conhecido como bomba de sódio e potássio. Por se tratar de um caso de transporte de substâncias, o mesmo ocorre através da membrana plasmática. Desse modo, esta função relaciona-se com a estrutura 7.

Resposta correta: letra A.

 

36) Esta questão requer conhecimento sobre os processos de transporte através da membrana plasmática e da importância da cadeia respiratória mitocondrial. Para resolvê-la, vamos relembrar o mecanismo de transporte de glicose e a importância da cadeia respiratória:

– Transporte de glicose: por ser uma molécula de maior tamanho, o transporte dessa substância através da membrana plasmática envolve, inicialmente, um processo de difusão facilitada, que conta com o auxílio de proteínas transportadoras e ocorre a favor do gradiente de concentração (área mais concentrada para a menos concentrada). Após a entrada inicial de glicose, o seu transporte passa a ocorrer contra o gradiente de concentração (da área menos concentrada para a mais concentrada) e passa a ser realizado por meio de um transporte ativo secundário (co-transporte com íons sódio).

– Cadeia respiratória: é uma das etapas do processo de respiração celular e, portanto, é responsável pela síntese de ATP (energia) na célula.

Agora, analisemos o enunciado da questão. Este exercício envolve a realização de uma experiência, em que um pedaço da alça do intestino é obtido e utilizado para formar uma pequena bolsa, de modo que a parte interna do intestino fique voltada para fora. O interior desta bolsa foi preenchido com uma solução salina (soro fisiológico). Após isso, essa bolsa foi mergulhada em uma solução salina contendo glicose. Por fim, mediu-se a variação da concentração de glicose presente na solução externa (fora da bolsa).

Então, pergunta-se qual curva do gráfico representa a experiência acima mencionada. Como resolver isso? Vamos raciocinar juntos. O enunciado diz que a solução externa contém glicose, enquanto a solução interna não possui este nutriente. Sendo assim, a solução externa está mais concentrada que a solução interna. Qual a tendência da glicose nessa situação? Ela deverá entrar na bolsa ou sair dela?

Nesta situação, como a concentração de glicose é mais alta na solução externa, a tendência é que a glicose comece a entrar na bolsa, ou seja, ela deverá passar da solução externa para a solução interna. Sabendo disso, o que ocorrerá com a concentração de glicose na solução externa? Se a glicose está saindo da solução externa para a interna, a concentração da mesma na solução externa deverá DIMINUIR.

Ao analisarmos o gráfico, vemos que somente duas curvas mostram a redução na concentração de glicose, a 2 e a 4. Mas como saber qual dessas representa a experiência?

Agora, devemos analisar uma segunda situação mencionada no enunciado, que é o fato de que, a partir de determinado momento T, adicionou-se um inibidor da cadeia respiratória. Então, devemos raciocinar: “Qual a influência que um inibidor da cadeia respiratória poderá ter sobre o transporte de glicose?”.

– Inicialmente, a concentração de glicose na solução interna era igual a zero. À medida que a glicose foi passando da solução externa para esta solução interna, sua concentração começou a aumentar na solução interna. Então, em determinado momento, a concentração de glicose torna-se mais alta na solução interna que na solução externa. A partir desse momento, o transporte de glicose da solução externa para a interna começa a ocorrer contra o gradiente de concentração (da área menos concentrada para a mais concentrada), o que caracteriza um transporte ativo. Neste momento, o transporte de glicose passa a depender da presença de ATP (energia), que também caracteriza o transporte ativo.

Sendo assim, o que ocorrerá quando colocamos um inibidor da cadeia respiratória? A resposta é simples:

“A cadeia respiratória participa da síntese de ATP e, portanto, se a inibirmos, não haverá produção do ATP. Sem ATP, o transporte ativo de glicose não poderá ocorrer.”

Desse modo, na presença do inibidor de cadeia respiratória, o transporte de glicose será interrompido, de modo que sua concentração permanecerá inalterada após a adição do inibidor. Sendo assim, a única curva que apresenta uma queda antes da adição do inibidor e que, após sua adição, permanece inalterada é a 2. Logo, a resposta correta é a letra B.

 

39) Esta questão aborda o processo de contração muscular. Então, vamos revisar algumas coisas sobre tal processo:

– As fibras musculares estão divididas em unidades menores chamadas de SARCÔMEROS. Cada sarcômero possui filamentos de actina (mais finos) e de miosina (mais grossos). Durante o processo de contração muscular, ocorre o encurtamento dos sarcômeros, envolvendo o deslizamento dos filamentos mais finos de actina sobre os filamentos mais grossos de miosina. Contudo, os sítios de ligação da miosina com a actina encontram-se bloqueados por proteínas chamadas de troponinas. Para que estes sítios sejam liberados, é necessária a ligação de íons cálcio com as troponinas. Sendo assim, para que ocorra a contração muscular, deverá ocorrer saída de íons cálcio do interior do retículo sarcoplasmático (forma especializada do retículo endoplasmático que armazena íons cálcio) para o sarcoplasma (forma especializada de citoplasma).

Imagem

Sendo assim, na contração muscular a concentração de íons cálcio irá diminuir no interior do retículo sarcoplasmático e aumentar no sarcoplasma. Se analisarmos o gráfico, veremos que a partir do tempo T3 até T6, a concentração de cálcion diminui no retículo e aumenta no sarcoplasma. Contudo, a pergunta questiona em qual intervalo temos o músculo sob contração máxima. A resposta é simples:

“A contração será máxima quando a concentração de cálcio for máxima no sarcoplasma e mínima no retículo sarcoplasmático.”

Se analisarmos o gráfico, o intervalo em que isso é observado é T6 a T8. Sendo assim, a resposta correta é a letra C.

 

41) Esta questão requer o conhecimento sobre os processos de partenogênese e mitose. Para isso, vamos relembrar o que é partenogênese:

“Processo de reprodução em que as fêmeas são geradas pela reprodução sexuada e fecundação cruzada. Os machos, por sua vez, são oriundos de óvulos não fecundados das fêmeas.” 

Tendo conhecimento disso e que o óvulo da abelha possui 5×10-14g de DNA, quanto DNA possuirá a célula do zangão? A resposta é simples: se o óvulo possui 5×10-14g e o zangão é oriundo do óvulo, a célula do zangão terá exatamente 5×10-14g. Mas se observarmos, não há nenhuma alternativa que contemple esta resposta.

Observemos que o enunciado menciona que a célula está em uma fase específica da mitose, chamada de prófase. Neste momento, a célula está na primeira etapa do processo de divisão celular. Então, é preciso lembrarmos que, antes da divisão celular, o DNA da célula é duplicado. Sendo assim, se duplicarmos 5×10-14g, teremos 10×10-14g (ou 1×10-13g) de DNA. Ao analisarmos as alternativas, novamente não encontramos essa resposta.

Observe que é perguntado qual a quantidade de DNA em miligramas. Neste caso, basta passar o valor que obtivemos acima para tal unidade (basta multiplicarmos o valor acima por 1000). Sendo assim, obteremos 1×10-10mg de DNA. Sendo assim, a resposta é a letra A.

 

42) A questão fala sobre o processo de digestão. No enunciado, cita-se uma enzima chamada de ptialina, encontrada na saliva. Vamos relembrar quem é essa enzima:

– A ptialina, também chamada de amilase salivar, é uma enzima que realiza a digestão do amido na boca.

Contudo, como o próprio enunciado diz, muitas pessoas não a produzem, mas não apresentam problemas na digestão do amido, pois outro suco digestivo contém uma enzima de ação similar à ptialina. Essa outra enzima também é uma amilase, que é encontrada no suco pancreático (daí ser chamada de amilase pancreática) e atua no duodeno. Sabendo disso, a resposta correta é a letra D.

 

45) A questão aborda a importância da ocorrência de erros para a evolução biológica. No texto-base para a questão, fala-se que os erros são importantes para o progresso. Em seguida, pergunta-se qual processo se relaciona com esse conceito de evolução apresentado no texto-base. Para resolver esta questão, basta lembrarmos um conceito essencial:

“A variabilidade genética entre as espécies e dentro de uma mesma espécie é um importante fator para evolução, visto que, quanto maior a variabilidade genética de uma espécie, maior será a capacidade de adaptação da espécie a mudanças no ambiente onde vive.”

Agora pergunto: “Qual a principal fonte de variação genética?”. A resposta é simples: a principal responsável pelas alterações genéticas são as mutações. Elas ocorrem ALEATORIAMENTE em função de erros durante a replicação do DNA, mas também podem ser induzidas por determinadas substâncias químicas ou mesmo por espécies reativas de oxigênio, entre outros. Sendo assim, a resposta correta é a letra D, visto que menciona a ocorrência de alterações aleatórias no DNA, o que caracteriza as mutações.

Vamos ver mais algumas questões da UERJ? Hoje temos os comentários das questões de biologia do primeiro exame qualificatório de 2003. O link para a prova pode ser encontrado abaixo:

http://www.vestibular.uerj.br/portal_vestibular_uerj/arquivos/arquivos2003/2003eq1_2de3.pdf

 

Resolução comentada

23) Esta resolução exige o conhecimento sobre o controle de pH sanguíneo e deslocamento de equilíbrio químico.

Em primeiro lugar, devemos recordar que o pH sanguíneo é influenciado diretamente pela concentração de gás carbônico (CO2) no sangue. Este gás é capaz de reagir com a água e formar íon H+ e bicarbonato. Sendo assim, quanto maior a quantidade de CO2, maior será a quantidade de H+ e, consequentemente, menor será o valor de pH, o que caracteriza um meio mais ácido.

Outro ponto que devemos ter conhecimento é sobre os conceitos de hipoventilação e hiperventilação. Esses conceitos fazem referência à intensidade da respiração, ou seja, se ela está mais lenta ou acelerada. A hiperventilação caracteriza-se por uma respiração mais acelerada, enquanto a hipoventilação envolve um ritmo respiratório mais lento. Sendo assim, estes processos terão influência direta sobre a velocidade da troca de gases nos alvéolos pulmonares. Na hiperventilação, tal troca é mais intensa, de modo que a eliminação de CO2 na expiração também seja maior.

Agora que revisamos estes tópicos, devemos avaliar a pergunta apresentada, que questiona como estará a concentração de H+ e o pH sanguíneo em um indivíduo sob hiperventilação. Já sabemos que sob hiperventilação, a velocidade das trocas gasosas é maior e, portanto, eliminamos mais CO2. Agora, devemos nos perguntar: “Se a concentração de CO2 diminui no sangue, o que ocorrerá com a concentração de H+?”. Para resolver lembre-se:

“Um aumento em qualquer das concentrações resulta em um deslocamento de equilíbrio para o outro lado. 
A retirada de alguma substância provoca o deslocamento para o seu lado.”

Obedecendo ao conceito acima apresentado, a redução da concentração de CO2 em função da hiperventilação deslocará a reação para o lado de formação do CO2. Sendo assim, a concentração de H+ irá estar baixa, o que faz com o que o pH do meio torne-se mais alto.

Desse modo, a resposta correta é a letra C.

 

31) A questão menciona o fenômeno de ressurgência, que envolve os casos em que correntes marinhas profundas chegam à superfície. O fato do fenômeno estar associado à correntes marinhas mais profundas envolve uma área onde a concentração de sais minerais é maior. Sendo assim, a resposta correta é a letra D.

 

33) A questão exige conhecimento sobre o processo de fotossíntese para sua resolução. Vamos então relembrar alguns pontos sobre tal processo:

– A fotossíntese está dividida em duas etapas essenciais chamadas de reações de claro (primeira fase) e reações de escuro (segunda fase);

– Durante a fase clara ocorre a fotólise da água, que produz oxigênio (O2) e as reações de fotofosforilação que produzem ATP e NADPH, que serão utilizados nas reações de escuro;

– A fase escura compreende a ocorrência do ciclo de Kalvin ou ciclo das pentoses, que realiza a fixação do CO2, produzindo açúcares.

Com base nas observações acima, podemos deduzir que a água produz o oxigênio durante a fase clara e que o CO2 forma os açúcares na fase escura. Então, as setas identificadas por 1, 2, 3 e 4 representam quais substâncias?

Sabemos que a água e o CO2 são reagentes no processo de fotossíntese. Logo, as setas tem que estar partindo deles. Desse modo, só podem ser representados pelas setas 1 e 4. Mas como saber qual seta representa cada um deles? Basta lembrarmos que a água participa da fase clara e que o CO2 participa da fase escura. Sendo assim, a água é representada pela seta 1, enquanto o CO2 é representado pela seta 4.

Sabendo apenas disso, podemos deduzir que a resposta correta é a letra D.

Para confirmar, lembre-se que o oxigênio é produto gerado na fase clara e que os açúcares são os produtos da fase escura.

 

34) Esta questão envolve conhecimentos sobre a fisiologia endócrina. No enunciado, é dito que foi feita a medição da pressão arterial e da frequência cardíaca (número de batimentos cardíacos por minuto) em um animal antes e depois da injeção de um extrato de glândula suprarrenal. Os resultados da experiência são representados em um gráfico, em que se indica as medições dos dois parâmetros antes da injeção e pergunta-se qual ponto do gráfico representa a medição após a injeção do extrato.

Para resolver esta questão, devemos relembrar as características da glândula suprarrenal, também chamada de adrenal. Esta glândula é encontrada acima dos rins e é responsável pela produção de alguns hormônios importantes em nosso corpo, como, por exemplo, os glicocorticoides, mineralocorticoides e a adrenalina. Mas como saber quais desses hormônios podem ter efeitos sobre a pressão arterial e a frequência cardíaca? Repare no enunciado é mencionado que o extrato foi produzido a partir da porção medular da glândula. Essa parte da suprarrenal é responsável pela produção de adrenalina, enquanto o córtex da glândula produz os outros hormônios.

Sabendo-se que o extrato foi produzido com a porção responsável por produzir adrenalina, quais os possíveis efeitos desse hormônio sobre o animal? A adrenalina apresenta diversos efeitos, como, por exemplo, elevação da frequência cardíaca, aumento do débito cardíaco (volume de sangue bombeado pelo coração por minuto) e, consequentemente, da pressão arterial, aumento da sudorese, estímulo à glinoneogênese (síntese de glicose), etc.

Tendo em vista os efeitos cardíacos da adrenalina, podemos deduzir que tanto a pressão arterial quanto a frequência cardíaca do animal deverão estar mais altas que antes da injeção. Sendo assim, a resposta correta é a letra B.

 

35) Esta questão exige conhecimento sobre a estrutura das mitocôndrias. Elas são organelas formadas por duas membranas: externa e interna. Além disso, temos o espaço intermembranas, a matriz mitocondrial e o DNA mitocondrial. Todas essas estruturas estão representadas na figura apresentada no enunciado da questão.

Agora devemos avaliar em qual dessas estruturas são encontradas a ATP sintase, os ribossomos e as enzimas responsáveis pela produção de CO2. Então, para resolver devemos sempre lembrar: 

– A ATP sintase é uma enzima responsável pela síntese de ATP nas mitocôndrias e é encontrada na membrana interna mitocondrial. Sendo assim, tal enzima é encontrada na estrutura representada pelo número 3;

Com base nesse conhecimento, já podemos deduzir que a resposta correta é a letra C. Todavia, é importante lembrarmos que:

– O gás carbônico (CO2) é produzido durante a respiração celular, especificamente durante a conversão do piruvato em Acetil-CoA e no ciclo de Krebs. Estas etapas ocorrem na matriz mitocondrial. Sendo assim, as enzimas que produzem CO2 são encontradas na matriz, que é representada pelo número 2;

– Como as mitocôndrias possuem DNA próprio, elas podem fabricar algumas de suas proteínas. Sendo assim, ela possui ribossomos em seu interior, mais especificamente na matriz mitocondrial. Estes ribossomos realizam a tradução do RNA mensageiro produzido a partir do DNA mitocondrial. Sabendo que são encontrados na matriz, tal estrutura é representada pelo número 2.

 

36) Esta questão aborda a temática da teoria evolutiva de Darwin. No enunciado, explica-se que, de acordo com tal teoria, as espécies portadoras de características mais vantajosas levam uma vantagem sobre espécies com as quais se esteja em competição. Na verdade, este é o princípio mais básico da teoria Darwiniana, que envolve a existência de variação entre espécies e a ação do ambiente, que seleciona os indivíduos portadores de caracteres mais adaptativos ou vantajosos, o que chamamos de seleção natural.

Em seguida, o enunciado apresenta quatro afirmativas e pergunta-se qual dessas afirmativas que, se fosse verdadeira, poderia por um fim às ideias apresentadas por Darwin. Para resolver a questão, vamos analisar cada situação separadamente:

– Afirmativa I: neste caso, diz-se que a quantidade de indivíduos que nascem é superior a quantidade de indivíduos que vivem. Tal afirmativa está de acordo com a teoria de Darwin, visto que, uma parte dos indivíduos nascidos, morre em função da competição entre os indivíduos dessa espécie ou com indivíduos de espécies diferentes.

LEMBRE-SE: a luta pela existência ou sobrevivência é um dos princípios norteadores da teoria de Darwin!

– Afirmativa II: diz-se que a luta pela existência deriva da rapidez com que os seres vivos se multiplicam ou reproduzem. Esta afirmativa também está de acordo com a teoria de Darwin, visto que a intensidade da competição tende a aumentar conforme as populações aumentam, pois os recursos disponíveis no ambiente tornam-se escassos mais rapidamente. 

Imagem

SUGESTÃO: http://www.youtube.com/watch?v=ZVj76SpbGeA (este link apresenta o filme intitulado “O desafio de Darwin”)

– Afirmativa III: este item menciona a seleção natural e diz que ela promove modificações em qualquer espécie para benefício de outra espécie. Esta afirmativa é contrária à teoria Darwiniana por dois motivos. O primeiro deles envolve o fato da seleção natural não provocar modificações, mas sim selecionar os caracteres em função de serem mais ou menos vantajosos. O segundo e mais importante envolve o fato das modificações trazerem benefícios para outra espécie; Darwin afirma exatamente o contrário, ou seja, as modificações trazem benefícios para a própria espécie.

Sendo assim, já podemos concluir que a letra C é a resposta correta. Contudo, vamos analisar a quarta afirmativa: 

– Afirmativa IV: tal afirmativa está de acordo com Darwin, visto que a seleção natural é responsável por selecionar os caracteres mais adaptativos, tornando a espécie mais adaptada que seus concorrentes.

Vamos discutir as questões de mais uma prova da UERJ? Abaixo se encontra o link para a prova:

http://www.vestibular.uerj.br/portal_vestibular_uerj/arquivos/arquivos2002/2002eq1_2de3.pdf

 

QUESTÃO 26

Esta questão exige o conhecimento de determinadas características de proteínas e do DNA, que são estudados na parte de bioquímica.

Para resolvê-la, teremos que associar as informações apresentadas no enunciado com as informações apresentadas no gráfico.

No enunciado, diz-se que o DNA apresenta carga negativa (lembre-se que isso se deve à presença de grupamentos fosfato nesta molécula) e está ligado com proteínas de caráter básico chamadas de histonas. Sabendo disso, precisamos julgar qual será a carga apresentada pelas histonas em pH básico, para que possamos determinar qual das quatro proteínas apresentadas no gráfico poderá ser uma histona. Para isso, basta lembrarmos da lei de atração e repulsão, que diz:

“Cargas opostas se atraem, enquanto cargas iguais se repelem.”

Tendo esse princípio em mente, podemos dizer que as histonas possuirão qual tipo de carga? Muito bem! Se o DNA possui carga negativa, só poderá interagir com proteínas que possuem carga positiva. Então, em pH básico, as histonas possuem carga positiva.

Agora vamos analisar o gráfico. Para determinar qual dessas proteínas pode ser uma histona, precisamos verificar qual delas apresenta carga positiva em pH básico (lembrando que pH básico é aquele acima de 7). Analisando o gráfico, vemos que somente a proteína W possui carga positiva em alguns valores de pH básico (entre 7 e 10). Logo, somente ela poderá ser uma histona.

Desse modo, a resposta correta é a letra A.

 

QUESTÃO 30

Essa questão pretende determinar o caminho percorrido por uma dada substância injetada por via venosa. Vamos raciocinar.

Uma injeção venosa é realizada em uma veia, um vaso sanguíneo que leva o sangue do corpo para o coração. Sendo assim, já podemos eliminar as alternativas A e C, que mencionam os pulmões como o primeiro destino dessa substância.

Após isso, devemos nos perguntar: “Por qual lado do coração o sangue proveniente do corpo retorna?”. A resposta é simples: o sangue proveniente das diversas partes do corpo retorna sempre pelo lado direito do coração. Então, o sangue contendo essa substância chegará no átrio direito e passará para o ventrículo direito. Este, por sua vez, bombeará o sangue para os pulmões (onde ocorre a troca de gases). Posteriormente, o sangue retornará ao coração pelo átrio esquerdo, passará para o ventrículo esquerdo. Este, por fim, bombeará o sangue para o corpo, incluindo o órgão-alvo da substância, que é o rim.

Desse modo, a resposta correta é a letra B.

Imagem

 

QUESTÃO 32

Essa questão exige alguns conhecimentos de fisiologia humana e metabolismo energético para a sua resolução. Repare que a frase apresentada diz que todo o oxigênio absorvido sob a forma de oxigênio, é eliminado sob a forma de gás carbônico. Esta frase sugere que o oxigênio é transformado em CO2 no nosso corpo, o que não é verdadeiro. Mas qual seria a justificativa desta afirmativa ser falsa? Vamos analisar cada alternativa apresentada na questão:

– Este item está incorreto, pois afirma que o CO2 é eliminado pelos rins sob a forma de bicarbonato. Essa é outra forma de excreção de gás carbônico pelo corpo, mas não é a principal, que envolve a eliminação deste gás por meio do processo expiratório. Alternativa incorreta.

– Os pulmões são responsáveis pela eliminação da maior parte do gás carbônico produzido em nosso metabolismo. Apenas uma pequena parcela é eliminada pela urina sob a forma de bicarbonato. Alternativa incorreta.

– O oxigênio atua como aceptor final de elétrons na cadeia respiratória mitocondrial e forma água ao término deste processo. Logo, a alternativa está correta.

– As reações metabólicas das células humanas envolvem a realização de processos que consomem o oxigênio, mas não o produzem. Logo, tal afirmativa é incorreta.

Sendo assim, a resposta correta é a letra C.

Imagem

 

QUESTÃO 35

Esta questão discute os dois tipos de hidrólise (quebra) a que a sacarose (um dissacarídeo) pode ser submetida: hidrólise ácida ou catálise enzimática.

Então, para resolvê-la, precisamos buscar diferenças entre a hidrólise ácida e a catálise enzimática. Como temos mais conhecimento sobre a ação das enzimas na parte de bioquímica, vamos relembrar algumas características da catálise enzimática:

– As enzimas são proteínas que aceleram as reações químicas;

– Reações enzimáticas são afetadas pela temperatura e pelo pH do meio, visto que alterações bruscas nestes fatores podem provocar desnaturação e perda da atividade enzimática;

– A concentração de substrato também afeta as reações enzimáticas. Inicialmente, a velocidade da reação tende a aumentar rapidamente (indica que o substrato é consumido rapidamente) e, posteriormente, a velocidade da reação vai diminuindo até se tornar constante.

Estas informações serão suficientes para resolvermos a nossa questão. Em primeiro lugar, pede-se para indicar quais curvas representam a hidrólise ácida e a catálise enzimática. Para resolvermos isso, vamos usar o gráfico de referência. Vamos anotar nossas observações com relação às curvas X e Y no gráfico de referência:

– A curva X é representada por uma reta decrescente, o que indica uma redução na concentração de sacarose ao longo do tempo.

– A curva Y indica um decréscimo mais rápido na concentração de sacarose seguido por um período de decréscimo mais lento, tendendo a ficar constante.

Sabendo disso, qual curva representa a hidrólise ácida? E a catálise enzimática? Pelas nossas anotações sobre a catálise enzimática feitas no início da resolução, podemos dizer que a curva Y representa a catálise enzimática, enquanto a curva X representa a hidrólise ácida. Podemos dizer isso, pois é notável que a velocidade da reação é muito maior na curva Y; observe que a concentração de sacarose cai mais rapidamente do que na curva X. Além disso, podemos observar que a curva tende a se estabilizar em determinado momento.

Agora precisamos determinar qual dos dois gráficos experimentais representam uma experiência realizada à 80ºC. Lembre-se que as enzimas humanas atuam em uma temperatura de 37ºC. Desse modo, a uma temperatura de 80ºC, as enzimas sofrerão desnaturação e perderão a sua atividade biológica (serão incapazes de realizar a sua função). Então, ao analisarmos os gráficos, veremos que, somente no gráfico 1, houve perda da atividade biológica, pois a curva Y se mantém constante, ou seja, a enzima não está digerindo a sacarose e por isso sua concentração não se altera.

Sendo assim, a resposta correta é a letra A.

Imagem

 

QUESTÃO 39

Esta questão se baseia em um texto que fala sobre o derramamento de óleo em ambientes aquáticos e discute o acúmulo dessas substâncias até que atinjam o topo da pirâmide alimentar.

Na pergunta, questiona-se qual o nome do processo de acúmulo de substâncias ao longo da pirâmide alimentar. Quatro alternativas diferentes são apresentadas. Vamos discuti-las:

– Biogênese: este é o nome dado a uma das principais teorias de origem da vida. Esta teoria elucida que um ser vivo só pode surgir a partir de outro ser vivo existente;

– Biossíntese: é a síntese biológica de diversas moléculas presentes nas células. Por exemplo, a biossíntese de ácidos graxos, de nucleotídeos, de aminoácidos, etc.

– Biodegradação: capacidade que uma substância tem de ser degradada biologicamente por seres vivos chamados de decompositores.

– Bioacumulação: acúmulo de substâncias não-biodegradáveis nos tecidos dos seres vivos, de modo que, ao se alimentarem, estas substâncias possam se acumular ao longo dos níveis tróficos das cadeias alimentares.

Com base nos conceitos apresentados acima, vemos a alternativa correta é a letra D. 

Revisão – Enzimas

Publicado: 6 de setembro de 2013 em Exame de qualificação da UERJ

1) A velocidade de reação V de uma enzima é dependente da concentração de seu substrato quando ele está em baixas concentrações; no entanto, quando essas concentrações são muito altas, V torna-se constante e é denominada velocidade máxima de reação (Vmáx). A tabela abaixo fornece algumas características das reações, determinadas em condições ideais, de uma mesma enzima atuando sobre três diferentes substratos, S1, S2 e S3.

Uma preparação desta enzima foi colocada em três frascos, adicionando-se a cada um deles um substrato diferente: S1, S2 ou S3. Estes substratos são, assim, transformados nos produtos P1, P2 e P3, respectivamente.

 

Considere que:

– a concentração de enzima foi a mesma em todos os frascos;

– a concentração de cada um dos substratos foi mantida constante e igual a 2 x10-9 mol/L, durante o experimento;

– as reações foram realizadas em condições ideais.

 

Ao fim de um minuto de reação, a ordem crescente das quantidades de produtos formados nos três frascos foi:

(A)P1 < P3 < P2

(B) P1 < P2 < P3

(C) P2 < P3 < P1

(D) P3 < P1 < P2

 

COMENTÁRIOS:

Esta é uma questão sobre enzimas, que aborda os efeitos da concentração de substratos sobre a velocidade das reações enzimáticas e o conceito de afinidade entre enzima e substrato.

Logo no início do enunciado, a banca explica que a velocidade da reação enzimática é dependente da concentração de substrato quando ele está em baixas concentrações e que, a partir de determinado ponto, a velocidade se torna constante. Mas por que isso acontece? A resposta é bastante simples: as reações enzimáticas são dependentes da interação entre enzima e substrato, que se dá pela ligação do substrato ao sítio ativo da enzima; no momento em que todos os sítios ativos estejam ocupados (ligados a moléculas de substratos), a velocidade da reação se manterá constante. Logo, não adianta adicionar mais moléculas de substratos, se não houver sítios ativos livres.

Logo abaixo, a banca fornece uma tabela que indica a velocidade máxima da reação e a concentração de substrato quando a reação atinge metade da velocidade máxima para três substratos diferentes (S1, S2 e S3). Esta informação é crucial para a resolução da questão. Para resolvê-la, vamos usar a dica abaixo:

– A concentração de substrato quando a reação atinge metade da velocidade máxima é chamada de CONSTANTE DE AFINIDADE. Quanto maior a concentração de substrato nesta velocidade, menor será a afinidade entre a enzima e o seu substrato e menor será a velocidade da reação.

Agora, vamos aplicar este conceito na resolução da questão. Vamos analisar a tabela: tentem verificar a ordem crescente da concentração de substrato quando a reação atinge a metade da velocidade máxima para os três substratos representados na tabela: S1, S2 e S3. Se vocês observarem com bastante atenção, poderão concluir que a ordem crescente de concentração nesta velocidade é: S2<S3<S1.

Agora vamos raciocinar. Seguindo a dica apresentada acima, me responda: “Qual a ordem de afinidade de cada substrato (S1, S2, S3) com a enzima?”. Aplicando o conceito da dica acima, veremos que a ordem de afinidade é: S1<S3<S2.

Agora que sabemos a afinidade de cada substrato pela enzima, vamos tentar ordenar as velocidades de formação dos produtos. Para isso, vamos aplicar novamente a dica acima, que diz que quanto menor a afinidade, menor será a velocidade da reação. Sendo assim: “Qual produto será formado mais rápido? E mais lentamente?”; o produto formado mais rápido será aquele que o substrato possui maior afinidade pela enzima e o mais lento será aquele cujo substrato possui menor afinidade pela enzima. Sendo assim, como o substrato S2 é aquele que possui maior afinidade pela enzima, o produto formado mais rapidamente será o P2. Por outro lado, o substrato que possui menor afinidade pela enzima é o S1; logo, o produto formado mais lentamente será o P1. Logo, a resposta correta é a letra A.

 

2) A equação química abaixo representa a hidrólise de alguns dissacarídeos presentes em importantes fontes alimentares:

A tabela a seguir relaciona os resultados da velocidade inicial de reação dessa hidrólise, em função da concentração e da temperatura, obtidos em quatro experimentos, sob as seguintes condições:

– soluções de um desses dissacarídeos foram incubadas com quantidades iguais ora de suco gástrico, ora de suco intestinal rico em enterócitos;

– o tempo de reação e outros possíveis fatores interferentes foram mantidos constantes.

Os experimentos que podem corresponder à hidrólise enzimática ocorrida quando o dissacarídeo foi incubado com suco intestinal são os de números:

(A) I e II

(B) I e IV

(C) II e III

(D) III e IV

 

COMENTÁRIOS:

Esta é uma questão clássica que estuda os efeitos de alguns fatores sobre as reações químicas. Lembre-se que uma série de fatores podem afetar as reações químicas. No caso de reações enzimáticas, três fatores são determinantes para a velocidade das reações: concentração de substrato, temperatura e pH.

Saber como a temperatura e o pH afetam a velocidade das reações enzimáticas é essencial para a resolução de algumas questões de vestibular. Lembre-se que toda enzima é uma proteína e, portanto, possui uma conformação nativa (forma como a proteína se dobra e se enrola em função das interações entre seus aminoácidos). Além disso, lembre-se que a conformação nativa afeta a atividade funcional de qualquer proteína ou enzima. Sendo assim, mudanças no pH e na temperatura são capazes de afetar a conformação nativa da proteína ou da enzima e, consequentemente, afetar a sua atividade e a velocidade das reações químicas.

Agora vamos tentar descobrir quais experimentos representam a hidrólise enzimática, ou seja, a reação que tem a participação de uma enzima. Para isso, vamos procurar experimentos em que houve alteração em algum destes fatores. No caso da questão, avaliou-se apenas a influência da concentração de substrato e da temperatura. Nos experimentos I e III manteve-se a concentração de substrato constante e variou-se a temperatura ao longo do tempo, enquanto nos experimentos II e IV manteve-se a temperatura e variou-se a concentração de substrato.

Com base em nossos conhecimentos sabemos que:

– A velocidade das reações enzimáticas varia em função da concentração de substrato quanto este está em baixas concentrações. A partir de determinada concentração, a velocidade da reação se torna constante.

Sendo assim, qual dos dois experimentos que variam a concentração de substrato (II ou IV), pode representar uma reação enzimática? Se você disse que o experimento IV, está correto. Nos dois experimentos, o aumento da concentração de substrato sempre leva a um aumento na velocidade da reação. Contudo, no experimento II, verificamos que, sempre que aumentamos a concentração de substrato, a velocidade aumenta 10 unidades. No experimento IV, por sua vez, verificamos que, à medida que aumentamos a concentração do substrato, a velocidade da reação aumenta; contudo, este aumento vai se tornando cada vez menor (repare que primeiro aumenta 20 unidades, depois só 5 unidades e depois só duas unidades), o que indica uma tendência a se tornar constante.

Agora vamos analisar os experimentos I e III. Então, pergunto a vocês: “Qual desses dois experimentos representa uma reação enzimática?”. Para auxiliá-los, tentem seguir a dica abaixo:

– Toda enzima possui um pH e uma temperatura ótimas para a sua atividade. As mudanças na temperatura e no pH podem provocar a desnaturação das enzimas ou proteínas, o que provoca a perda da conformação nativa e a perda de atividade biológica (a enzima deixa de funcionar), o que leva a uma queda brusca na velocidade da reação.

A partir desta dica, a qual conclusão podemos chegar? Se você disse que o experimento I representa a reação enzimática, está correto. Observe que no experimento III, a velocidade da reação sempre aumenta conforme aumentamos a temperatura; isso contradiz a dica acima. Sendo assim, a reação enzimática é representada pelo experimento I, visto que existe uma temperatura (40ºC) em que a atividade enzimática é máxima. Além disso, quando aumentamos a temperatura para 80ºC, a velocidade da reação cai bruscamente (isso é um clássico indicativo de que a reação é catalisada por uma enzima).

Sendo assim, a resposta correta é a letra B.

 

3) Existem dois tipos principais de inibidores da atividade de uma enzima: os competitivos e os não competitivos. Os primeiros são aqueles que concorrem com o substrato pelo centro ativo da enzima. Considere um experimento em que se mediu a velocidade de reação de uma enzima em função da concentração de seu substrato em três condições:

• ausência de inibidores;

• presença de concentrações constantes de um inibidor competitivo;

• presença de concentrações constantes de um inibidor não competitivo.

Os resultados estão representados no gráfico abaixo:

A curva I corresponde aos resultados obtidos na ausência de inibidores. As curvas que representam a resposta obtida na presença de um inibidor competitivo e na presença de um não competitivo estão indicadas, respectivamente, pelos seguintes números: 

(A) II e IV

(B) II e III

(C) III e II

(D) IV e III

 

COMENTÁRIOS:

Esta questão aborda o tema inibição enzimática. Para resolvê-la, devemos aplicar as seguintes dicas:

– Inibição competitiva: o inibidor é parecido com o substrato e compete com ele pela ligação ao sítio ativo da enzima, ou seja, ele afeta a ligação da enzima ao substrato. Contudo, se a concentração de substrato for mais elevada que a do inibidor, o substrato poderá se ligar a enzima e a reação ocorrerá normalmente, atingindo a MESMA velocidade máxima que a reação na ausência do inibidor. Então, neste tipo de inibição, a reação atinge a velocidade máxima, mas demora mais tempo para isso e exige uma concentração de substrato maior.

– Inibição não-competitiva: o inibidor afeta a estrutura química da enzima (altera sua conformação nativa). Neste caso, a reação nunca atingirá a mesma velocidade máxima que a reação na ausência do inibidor.

Agora vamos pensar. Tentem aplicar os conceitos acima na análise do gráfico da questão. Sabendo que, na inibição competitiva, a reação atinge a velocidade máxima, qual curva do gráfico representa esta situação? Se analisarmos o gráfico, veremos que somente uma curva, a II, representa uma reação na presença de inibidor, que atinge a velocidade máxima. Logo, a curva II representa a ação de um inibidor competitivo.

Agora tentem observar no gráfico qual a curva em que a reação ocorre, mas não se atinge a mesma velocidade máxima que a reação na ausência do inibidor. Se observarmos com atenção, somente a curva III representa tal situação. Logo, ela representa a ação de um inibidor não-competitivo.

Sendo assim, a resposta correta é a letra B. 

 

4) Em um experimento, em condições adequadas, foram medidas as velocidades de reação V de uma enzima, em função do aumento da concentração de seu substrato S. O gráfico abaixo indica variações de 1/v em função de S.

A curva que deve representar o resultado experimental é a identificada por:

(A) W

(B) X

(C) Y

(D) Z

 

COMENTÁRIOS:

Esta é outra questão que relaciona a velocidade de uma reação enzimática com a concentração de substrato. Para resolvê-la, basta seguirmos a seguinte dica:

– A velocidade das reações enzimáticas varia em função da concentração de substrato quanto este está em baixas concentrações. A partir de determinada concentração, a velocidade da reação se torna constante.

A partir desta dica, pergunto a vocês: “Qual curva do gráfico representa a reação enzimática?”. Acredito que muitos de vocês tenham pensado logo na curva X, mas tenham muito cuidado e atenção nesta questão. Ela possui uma pegadinha. Se o gráfico representasse a concentração de substrato no eixo X e a velocidade da reação no eixo Y, a resposta correta seria realmente a curva X. Contudo, o eixo Y representa o inverso da velocidade (1/v). Logo, a curva da reação enzimática estará invertida. Sendo assim, a resposta seria a letra D (curva Z). 

 

BOM ESTUDO A VOCÊS!!!

1) A figura abaixo representa uma célula de uma planta jovem.

Considere duas situações: 

1) a célula mergulhada numa solução hipertônica;

2) a célula mergulhada numa solução hipotônica. 

Dentre as figuras numeradas de I a III, quais representam o aspecto da célula, respectivamente, nas situações 1 e 2?

a) I e II.

b) I e III.

c) II e I.

d) III e I.

e) III e II.

 

COMENTÁRIOS:

Esta é uma clássica questão sobre osmose em células vegetais. Sempre que questões sobre osmose forem abordadas em provas de vestibular, basta seguir as seguintes regras:

– Célula em meio hipotônico: ocorre absorção de água, fazendo com que a célula fique túrgida (“inchada”).

– Célula em meio hipertônico: ocorre perda de água, fazendo com que a célula fique murcha.

Sendo assim, seguindo estas idéias, podemos concluir que, na situação 1, a célula murchará e, na situação 2, a célula ficará túrgida. Analisando as figuras, tentem verificar qual célula está murcha e qual célula ficou túrgida. Observe as figuras com atenção e verificará que a figura I representa uma célula que aumentou de volume; portanto, túrgida. Já a célula III indica uma célula que passou por uma retração de volume; portanto, murcha. Sendo assim, a resposta correta é a letra D.

 

Importante pra caramba (IPC)!!!!!!

Não se esqueça que existem diferenças marcantes entre a osmose em células animais e vegetais. Na célula animal, a absorção excessiva de água poderá provocar a RUPTURA da membrana plasmática. Isto não ocorre em células vegetais, visto que estas possuem uma estrutura chamada de PAREDE CELULAR, que confere rigidez e proteção à célula.

 

2) Um pesquisador verificou que a substância por ele estudada apresentava como efeito, em meio de cultura de linfócitos, a diminuição da concentração intracelular do íon potássio. A explicação admitida pelo pesquisador para essa diminuição foi a ocorrência de alterações na função de, pelo menos, um dos seguintes sistemas: a bomba de sódio-potássio, os canais de transporte passivo de potássio ou a síntese de ATP na célula. Os gráficos abaixo mostram possíveis alterações nas funções de cada um desses sistemas; o ponto 0 representa a função normal, na ausência da substância estudada, e o sinal positivo e o negativo representam, respectivamente, o aumento e a diminuição da função.

O gráfico no qual cada um dos três sistemas apresenta uma alteração compatível com o efeito da substância é o de número:
(A) I
(B) II
(C) III
(D) IV

 

COMENTÁRIOS:

Esta é uma questão clássica sobre transporte transmembrana, que aborda os conceitos de transporte passivo, transporte ativo e bomba de sódio e potássio.

No enunciado é mencionado que um pesquisador tratou algumas células (linfócitos) com determinada substância, o que provocou uma queda na concentração de íons potássio no interior da célula. Além disso, a banca associa tal efeito a uma alteração em algum dos três sistemas apresentados na questão: atividade da bomba de sódio e potássio, permeabilidade dos canais de potássio e síntese de ATP.

Para resolver esta questão, basta lembrarmos que a principal forma de transportar potássio pela membrana é a bomba de sódio e potássio, que é um tipo de transporte ativo.  Então, vamos relembrar alguns pontos sobre esse tipo de transporte:

– Ocorre contra o gradiente de concentração, ou seja, as partículas de soluto se movimentam da área menos concentrada para a mais concentrada.

– Ocorre gasto de ATP (energia).

Relembrando este ponto, podemos verificar que dois dos sistemas apresentados na questão estão diretamente relacionados. Quais são eles? Se você pensou na bomba de sódio e potássio e na síntese de ATP, está correto.

Então, vamos imaginar: “O que ocorrerá com a bomba de sódio e potássio caso a síntese de ATP seja afetada, por exemplo, diminuída?”. Pense o seguinte: o transporte ativo depende de ATP; logo, se não temos ATP, não haverá transporte ativo.

Agora vamos raciocinar: se estes dois sistemas estão relacionados, o aumento na função de um deles levará ao aumento na função do outro e vice-versa. Sendo assim, devemos procurar gráficos que obedeçam a este preceito: “Se a síntese de ATP diminui, o transporte ativo também diminui e vice-versa”.

Agora, analisem os gráficos da questão e tentem identificar qual(is) deles apresenta esta característica. Muito bem, se você viu que o gráfico I é o único com esta característica, está correto!

Sendo assim, a resposta correta é a letra A.

 

DICAS IMPORTANTES (NÃO SE ESQUEÇA!!): 

– Transporte passivo (difusão simples, difusão facilitada e osmose) ocorrem sem gasto de energia e, nos casos de difusão simples e facilitada, a favor do gradiente de concentração (da área mais concentrada para a menos concentrada).

– Transporte ativo sempre gasta ATP (energia). Sendo assim, se a síntese de ATP for bloqueada por alguma razão, o transporte ativo não irá ocorrer.

1) Algumas células da pele de uma mesma rã foram retiradas em sua fase girino e, depois, em sua fase adulta. Observe a tabela abaixo, na qual são mostradas as combinações possíveis das macromoléculas DNA e RNA mensageiro.

foto 1

 

Os resultados referentes à comparação das macromoléculas das células da rã nas fases girino e adulta estão indicados pelos seguintes números:

(A) 1 e 3

(B) 1 e 4

(C) 2 e 3

(D) 2 e 4

 

COMENTÁRIOS:

Esta é uma questão que exige conhecimentos sobre DNA e RNA. No enunciado é dito que foram removidas células de um girino e uma rã adulta e que, após isso, foi realizada uma comparação entre o DNA e os tipos de RNAm destas duas células. Lembre-se de dois pontos chaves para resolver estas questões:

– Após a diferenciação celular, que ocorre na transformação dos girinos em animais adultos, o DNA permanece inalterado. As células continuarão contendo a mesma informação genética.

– Após a diferenciação celular, ocorre mudança nos tipos de RNAm. Isso se deve ao fato das células se tornarem mais especializadas; logo, irão expressar apenas os genes das proteínas relacionadas com as suas funções.

Obs: estas regras valem para qualquer processo de diferenciação celular, que ocorra em qualquer ser vivo.

Sendo assim, a resposta desta questão e letra B.

 

2) Uricotélicos são animais que excretam nitrogênio através de sua incorporação em ácido úrico, substância pouco solúvel em água. Já os mamíferos excretam o nitrogênio sob a forma de ureia, composto muito solúvel em água. Considere a hipótese de que, em algum momento do futuro da Terra, a água se torne progressivamente escassa. No gráfico abaixo, as curvas representam as taxas de crescimento populacional de diversos grupos animais em função da crescente dificuldade de obtenção de água.

foto 1

 

Com base no conceito de seleção natural, a curva que poderia representar os animais uricotélicos é a identificada por:

(A) P

(B) Q

(C) R

(D) S

 

COMENTÁRIOS:

A leitura inicial do enunciado dá a falsa impressão de que a questão aborda o tópico sobre fisiologia excretora. Contudo, a pergunta é bastante clara quando se refere à seleção natural; portanto, trata-se de uma questão sobre evolução das espécies.

Para resolvê-la, vamos relembrar o conceito de seleção natural. Esta teoria foi desenvolvida por Charles Darwin e seus preceitos foram publicados no livro “A origem das espécies” em 1859. Ela aborda a idéia de que existe variação entre os diferentes indivíduos (hoje sabemos que a fonte desta variação é a ocorrência das mutações, assim como a recombinação gênica e a reprodução sexuada) e que o ambiente seleciona as características mais vantajosas e adaptadas para sobreviver naquela condição ambiental. Com esses conceitos poderemos responder a esta questão.

Agora vamos buscar as informações relevantes para a resolução. São elas:

– Uricotélicos eliminam o ácido úrico, que é pouco solúvel em água.

– Ureotélicos eliminam a uréia, que é muito solúvel em água.

– Condição ambiental: a água se tornou escassa.

 

Agora vamos raciocinar juntos: “Sob escassez de água, os animais poderão perder grandes volumes de água na urina ou deverão reter mais líquido?”; se você pensou que deverão evitar a perda de água (reter mais líquido), está correto. Agora vamos pensar: “Qual grupo de animais está mais adaptado a evitar a perda de água?”; o enunciado nos dá essa informação, dizendo que animais uricotélicos eliminam um resíduo pouco solúvel em água. Sendo assim, os uricotélicos são os animais mais bem adaptados a esta condição ambiental. Então: “O que deverá ocorrer com a população de uricotélicos?”. Vamos aplicar o conceito da seleção natural para responder isso. Os indivíduos mais adaptados tendem a sobreviver; uma vez que sobrevivem, poderão se reproduzir, o que levará ao aumento do tamanho da população destes indivíduos. Sendo assim, ao analisarmos o gráfico, veremos que a única curva que representa o crescimento da população é a curva S. Logo, a resposta correta é a letra D. 

 

FAÇAM BOM PROVEITO!!!

1) Qualquer célula de um organismo pode sofrer mutações. Há um tipo de célula, porém, de grande importância evolutiva, que é capaz de transmitir a mutação diretamente à descendência. As células com essa característica são denominadas:

(A) diplóides

(B) somáticas

(C) germinativas

(D) embrionárias

 

COMENTÁRIOS:

Para resolvermos esta questão é necessário lembrarmos o conceito de mutação e o tipo de célula capaz de transmiti-las. Uma mutação é uma alteração na sequência de DNA, que pode ou não alterar a sequência de aminoácidos presentes na proteína. Estas mutações podem ser transmitidas aos descendentes somente por um tipo celular. Agora vamos pensar: “Qual célula é responsável por transmitir as características dos pais para os filhos?”; se você pensou nos gametas, está correto. Por fim, é importante lembrarmos que os gametas são células que possuem metade da quantidade de cromossomos; portanto, não podem ser células diplóides, nem somáticas e nem embrionárias. Logo, a resposta correta é a letra C.

 

2) O hormônio aldosterona, produzido pela região cortical das glândulas suprarrenais, aumenta a absorção do íon Na+ pelos túbulos renais. Quanto menor a concentração desse íon nos líquidos extracelulares, maior é a produção de aldosterona. Em um experimento para analisar o funcionamento dos túbulos renais, alguns pacientes foram submetidos a quatro diferentes dietas alimentares. Os resultados obtidos estão indicados no gráfico abaixo, no qual a barra I corresponde à taxa de absorção de água em um paciente com valor normal de concentração extracelular de Na+

Imagem

 

A barra que indica o resultado correspondente a um paciente submetido a uma rígida dieta de restrição de NaCl é a de número:

(A) II

(B) III

(C) IV

(D) V

 

COMENTÁRIOS

O enunciado desta questão apresenta informações relevantes: quanto menor a concentração de sódio nos líquidos extracelulares, maior será a produção de aldosterona e que este hormônio induz a absorção de sódio. Utilizando estas duas informações, podemos resolver esta questão. Vamos ver como?

Na resposta, a banca quer que indiquemos qual barra do gráfico representa o indivíduo submetido a uma dieta de restrição de NaCl. Então, vamos analisar a situação: “Sob dieta de restrição de NaCl, a concentração de sódio irá diminuir ou aumentar no corpo?”; se você pensou em diminuir, está correto. Então, temos que nos perguntar: “Nesta condição, a reabsorção de sódio irá aumentar ou diminuir?”; muito bem, irá aumentar, pois sob baixa ingestão de sódio, o corpo necessitará reter mais sódio no corpo. Por fim, temos que pensar: “Se a reabsorção de sódio aumentar, o que ocorrerá com a taxa de absorção de água?”. Neste caso, a maior retenção de sódio irá estimular a maior absorção de água. Logo, a resposta correta será letra B, que indica a curva III.

 

3) A mutação no DNA de uma célula eucariota acarretou a substituição, no RNA mensageiro de uma proteína, da 15ª base nitrogenada por uma base C. A disposição de bases da porção inicial do RNA mensageiro da célula, antes de sua mutação, é apresentada a seguir:

Imagem

 

Observe os códons correspondentes a alguns aminoácidos:

Imagem

 

Sabe-se que o códon de iniciação de leitura é AUG. A probabilidade de que a proteína a ser traduzida pelo RNA mensageiro da célula que sofreu mutação não apresente alterações na disposição de seus aminoácidos é de:

(A) 0

(B) 0,25

(C) 0,50

(D) 1,00

 

COMENTÁRIOS:

Nesta questão devemos nos lembrar de que o código genético é um código de trincas, ou seja, cada trinca de nucleotídeos codificará um determinado aminoácido.

Após isso, é necessário identificar em qual ponto da sequência houve a mutação. No enunciado é dito que a mutação ocorreu na décima quinta base nitrogenada. Então, vamos analisar a sequência apresentada na questão e tente me responder: “Qual foi a troca observada?”. Se você tiver tido atenção, verificou que a décima quinta base nitrogenada é uma uracila (U) e que a trinca encontrada na proteína normal é UUU. Agora, vamos olhar o enunciado. Se você teve atenção, verá que é dito que esta base foi substituída por uma citosina (C); logo, a trinca na proteína alterada é UUC.

Uma vez que já identificamos a mutação e quais as trincas que são encontradas nas proteínas normal e alterada, poderemos saber qual aminoácido é encontrado nesta posição. Então, comparando tal informação com aquela apresentada na tabela, verificaremos que as trincas UUU e UUC indicam um mesmo aminoácido, a fenilalanina.

Sendo assim, pergunto: “Qual a probabilidade de haver troca no aminoácido em função desta alteração?”. Se não houve mudança de aminoácido, a probabilidade de não ocorrer mudança no aminoácido é igual a um. Logo, a resposta é letra D.

 

4) Durante o ciclo menstrual, as concentrações sanguíneas de hormônios hipofisários e ovarianos sofrem notáveis variações. Os gráficos abaixo ilustram essas variações, ocorridas durante um ciclo de 28 dias.

Imagem

 

O gráfico que representa o hormônio progesterona, em um ciclo menstrual normal, está indicado pela seguinte letra:

(A) W

(B) X

(C) Y

(D) Z

 

COMENTÁRIOS:

Esta é uma questão que tem sido comum nos dois últimos anos e exige conhecimento sobre o funcionamento do ciclo menstrual.

O ciclo menstrual é caracterizado por uma série de eventos, como, por exemplo, ovulação, espessamento do endométrio e descamação do útero (menstruação). Ele tem a participação de quatro hormônios: FSH, LH, progesterona e estrogênio.

Para resolver esta questão, devemos entender quais hormônios em casa fase do ciclo menstrual.  O ciclo está dividido em três períodos básicos: fase pré-ovulatória, ovulação e fase pós-ovulatória.

Na fase pré-ovulatória, o aumento nos níveis de FSH leva ao amadurecimento de folículos ovarianos, enquanto o pico de LH coincide com a liberação do óvulo (ovulação). Além disso, o aumento nos níveis de estrogênio durante esta fase leva ao espessamento do endométrio.

Na fase pós-ovulatória, verificamos um aumento significativo nos níveis de progesterona, que inibe a menstruação e induz o espessamento do endométrio.

Com as informações discutidas acima já é possível responder a questão. Então, pergunto a vocês: “Quais hormônios atuam na fase pré-ovulatória e na fase pós-ovulatória?”. Se você pensou que FSH, LH e estrogênio atuam na fase pré-ovulatória e que a progesterona atua na fase pós-ovulatória está perfeitamente correto. Sendo assim, verificamos que o único gráfico que mostra um hormônio que atua somente na fase pós-ovulatória é o gráfico W. Logo, a resposta correta é letra A.

 

5) A atividade das enzimas no organismo humano varia em função do pH do meio.

Observe o gráfico:

Imagem

 

A curva que representa a variação da atividade da quimiotripsina, enzima proteolítica encontrada no suco duodenal, é a identificada pela seguinte letra:

(A) W

(B) X

(C) Y

(D) Z

 

COMENTÁRIOS

Esta é uma questão que fala sobre fisiologia digestiva. Observe que uma enzima é citada: a quimiotripsina. Além disso, é mencionado no enunciado que ela está presente no duodeno. Estas duas informações são essenciais.

Para resolver esta questão basta lembrarmos do pH característico de cada órgão digestivo e cruzar tal informação com o órgão onde a enzima citada é encontrada.

No enunciado, diz-se que a quimiotripsina é encontrada no suco duodenal. Então, vamos pensar: “O duodeno é uma parte de qual órgão?”; muito bem, se você disse intestino delgado, está correto. Agora, vamos nos perguntar: “Qual o pH característico dos sucos digestivos que atuam neste órgão?”. Use a tabela abaixo como consulta importante para resolver questões sobre digestão:

Imagem

 

Usando esta tabela, podemos verificar que o pH característico das enzimas intestinais está compreendido no intervalo entre 7 e 8. Logo, a curva X é a única que representa uma enzima intestinal como a quimiotripsina. Sendo assim, a resposta correta é a letra B.

 

6) Um dos equipamentos de segurança de uma cápsula espacial tripulada efetua a remoção do gás carbônico desse ambiente. Admita que, após um acidente, esse equipamento tenha deixado de funcionar. Observe as curvas do gráfico abaixo:

Imagem

 

A curva que representa a tendência do que deve ter ocorrido, após o acidente, com o pH sanguíneo dos tripulantes está identificada por:

(A) W

(B) X

(C) Y

(D) Z

 

COMENTÁRIOS:

Esta questão fala sobre um equipamento responsável pela remoção do gás carbônico. Então: “O que ocorrerá caso esse equipamento deixe de funcionar?”; se você pensou que o gás carbônico irá se acumular, está correto. Agora, perguntou a vocês: “O que ocorrerá com o pH sanguíneo caso o gás carbônico se acumule?”. Neste momento, lembre-se o gás carbônico pode se combinar com a água formando o ácido carbônico, o que aumenta a acidez do sangue.

Lembre-se da escala de pH: quanto maior a acidez, menor o pH. Sendo assim, se houve acúmulo de gás carbônico devido a falha no funcionamento do equipamento, o pH do sangue irá se tornar mais ácido e menor. Logo, a resposta correta é a letra D.

FAÇAM BOM PROVEITO!!!