1º EXAME DE QUALIFICAÇÃO – UERJ – 2015

Publicado: 11 de junho de 2014 em Exame de qualificação da UERJ, Sem categoria

Vamos lá galerinha!!!

O primeiro exame de qualificação da UERJ já passou e agora temos que nos preparar para o segundo exame de qualificação, que será em Setembro. Hoje trago o comentário das questões de Biologia presentes na prova de domingo passado, com direito a um comentário detalhado da questão 41, que deixou muitos alunos confusos com seu enunciado. Felizmente, a questão foi anulada pela universidade. Vamos estudar!

 

30) Esta questão requer conhecimento sobre o processo evolutivo das plantas terrestres. Para resolvê-la, basta termos conhecimento sobre as principais características dos quatro grupos de vegetais.

– Briófitas: são os vegetais mais simples encontrados em ambiente terrestre e caracterizam-se por serem avasculares (não possuem vasos condutores de seiva) e por viverem em ambientes úmidos. Além disso, sua reprodução é dependente de água. Os principais exemplos desse grupo são os musgos, hepáticas e antóceros;

– Pteridófitas: são vegetais vasculares (possuem vasos condutores de seiva) e reprodução dependente de água. As samambaias e avencas são os principais representantes deste grupo;

– Gimnospermas: são vegetais vasculares e possuem sementes e reprodução independente de água. Os pinheiros, encontrados na mata de araucárias, são os principais representantes deste grupo;

– Angiospermas: são vegetais vasculares, que possuem sementes e frutos e reprodução independente de água. As árvores frutíferas são os principais representantes deste grupo.

Tendo em vista as informações acima, podemos dizer que pteridófitas, gimnospermas e angiospermas formam um grupo de vegetais chamados vegetais vasculares, pois possuem tecidos condutores de seiva. Além disso, gimnospermas e angiospermas, formam um grupo chamado de fanerógamas, pois possuem sementes e reprodução independente de água.

Sabendo disso, podemos analisar o cladograma. A característica A está presente em todos os grupos de vegetais terrestres. A característica B está presente somente em pteridófitas, gimnospermas e angiospermas. A característica C, por sua vez, está presente somente em gimnospermas e angiospermas. Sabendo disso, podemos deduzir que as características B e C são, respectivamente, a presença de tecidos vasculares e a presença de sementes. Ao analisarmos as alternativas, vemos que só o item D apresenta tal resposta e, portanto, é a resposta correta.

 

31) Esta questão poderia ser resolvida do ponto de vista da química ou da biologia. O enunciado fala sobre a queima de combustíveis fósseis e seus impactos sobre a intensidade do efeito estufa e pergunta-se qual óxido ácido seria o principal responsável por esse processo. Do ponto de vista da biologia, basta lembrar que o CO2 é o principal gás responsável pelo aquecimento do planeta. Do ponto de vista da química, basta lembrar que o processo de combustão completo produz, geralmente, gás carbônico e água.

 

35) Esta questão aborda o tópico sobre osmorregulação em peixes. Para resolvê-la, vamos compreender a situação apresentada na questão. O enunciado fala sobre espécies de peixes que vivem em água doce, mas que conseguem sobreviver mesmo em condições nas quais a salinidade está mais elevada. Analisemos como estará a concentração de sais em um peixe de água doce:

“Em água doce, a concentração de sais é relativamente baixa, de modo que os peixes que vivem nesse ambiente apresentam maior concentração de sais no interior das suas células, ou seja, o meio da água doce é hipotônico (menos concentrado) em relação ao interior das células dos peixes.”

Se a concentração de sais é maior no interior das células, a tendência é que haja entrada de água nas células do peixe, provocando um aumento no volume celular. Para compensar essa entrada excessiva de água, os peixes de água doce tendem a formar grande quantidade de urina, para eliminar esse excesso de água.

Agora vamos analisar a situação apresentada na questão: diz-se que um rio sofreu um processo de salinização, ou seja, houve aumento na concentração de sais e que o peixe responde eliminando mais urina e reabsorvendo mais sais. Se o animal está eliminando mais urina, ele estará eliminando mais água. Com isso, podemos dizer que, por eliminar mais água, o animal estará em um meio com concentração mais elevada. Ao analisarmos as alternativas, vemos que o trecho Y é aquele que apresenta maior concentração de sais e também não está muito distante da concentração original. Logo, a resposta correta é o item C.

  

37) Esta questão poderia ser resolvida tanto pela química quanto pela biologia. No enunciado, fala-se sobre um tipo de interação química que é responsável pelo pareamento de bases no DNA. Com essa informação, devemos nos perguntar qual tipo de interação química é responsável pela união da dupla fita de DNA. A resposta é simples: PONTES DE HIDROGÊNIO. Do ponto de vista da química, bastava lembrarmos que as moléculas de água encontram-se altamente coesas e unidas por conta das pontes de hidrogênio formadas entre elas. Logo, a resposta correta é a letra C.

 

39) O enunciado desta questão fala sobre a presença de membranas interdigitais em embriões de alguns vertebrados. Uma membrana interdigital é um pedaço de tecido localizado entre os dedos, que é observado em algumas espécies adultas, como, por exemplo, em anfíbios aquáticos e algumas aves. No enunciado, diz-se que, em determinado momento do desenvolvimento, o citoplasma da célula libera enzimas que digerem essas membranas. Essa informação é crucial para a resolução da questão. Repare que ele fala em enzimas e digestão. Somente uma organela citoplasmática possui função de digestão intracelular e é conhecida como LISOSSOMO. Logo, a resposta correta é a letra A.

 

41) Esta questão apresenta um tópico que a UERJ tradicionalmente em suas provas, que é a ocorrência de mutações e as possíveis alterações na sequência de aminoácidos de uma proteína. Comentei sobre isso no facebook do blog e também apresentei resoluções de algumas questões sobre tal assunto anteriormente.

O enunciado fala sobre a ocorrência de mutações no RNAm (RNA mensageiro).Lembre-se que mutações são alterações que ocorrem na sequência de DNA e que, consequentemente, podem alterar a o RNAm (produzido a partir de sequências de DNA). Isso seria um erro conceitual da questão.

Ainda no enunciado, diz-se que podem ocorrer substituições simultâneas de bases nitrogenadas adjacentes. Uma substituição é a troca de um nucleotídeo contendo uma dada base nitrogenada por outro nucleotídeo contendo uma base diferente. Sendo assim, a substituição não altera a quantidade de nucleotídeos presentes na sequência de RNAm mensageiro. Essa informação é de grande valia!

Então, pergunta-se qual alternativa apresenta o número de substituições que irá provocar maior alteração na estrutura da proteína formada.

Para alterar a proteína formada, é necessário que haja alteração na sequência de seus aminoácidos, que é determinada pela sequência do RNA mensageiro. Lembre-se que cada trinca de nucleotídeos (cada trinca de letras) do RNAm é chamada de códon e cada uma delas indica um aminoácido específico.

Para compreendermos essa questão e possamos analisá-la, vamos usar uma sequência aleatória:

 

AUGGCCCCAUUUGUGGCAUAG

 

Tendo em vista as informações acima, analisemos cada alternativa:

 

1) Letra A: diz que ocorrem 3 substituições. Se houvessem substituições em três bases adjacentes (que estão uma ao lado da outra), haveriam as seguintes possibilidades:

 – Troca de uma trinca inteira, como mostrado abaixo:

 Sequência normal: AUGGCCCCAUUUGUGGCAUAG

Sequência alterada: AUGCAACCAUUUGUGGCAUAG

Repare que trocamos um códon inteiro. Então, se trocamos um códon, poderíamos trocar um aminoácido.

 

– Troca de dois nucleotídeos numa trinca e um nucleotídeo em outra trinca, como mostrado abaixo:

Normal: AUGGCCCCAUUUGUGGCAUAG

Alterada: AUGGCCCCAUGGCUGGCAUAG

Repare que trocamos duas bases na trinca UUU, que passou a ser UGG. E trocamos uma base na trinca GUG, que passou a ser CUG. Neste caso, poderíamos trocar até dois aminoácidos.

 

2) Letra B: diz que ocorre 4 substituições. Neste caso, teríamos duas possibilidades:

– Troca de uma trinca inteira e mais uma base em outra trinca, como mostrado abaixo:

Normal: AUGGCCCCAUUUGUGGCAUAG

Alterada: AUGCAAGCAUUUGUGGCAUAG

Repare que aqui podemos trocar uma trinca inteira (GCC por CAA) e mais uma base de outra trinca (CCA por GCA). Neste caso, estamos alterando até dois códons e, portanto, poderíamos modificar dois aminoácidos.

 

-Troca de duas bases em um códon e outras duas bases em outro códon:

Normal: AUGGCCCCAUUUGUGGCAUAG

Alterada: AUGGGGGGAUUUGUGGCAUAG 

Repare que aqui poderia estar trocando GCC por GGG (mudei duas bases C por G) e CCA por GGA (mudei duas bases C por G). Neste caso, estou alterando dois códons e, portanto, poderia mudar dois aminoácidos.

 

3) Letra C: diz-se que ocorre 6 substituições nas bases adjacentes. Com isso, teríamos as seguintes possibilidades:

– Troca de dois códons inteiros, como mostrado abaixo:

Normal: AUGGCCCCAUUUGUGGCAUAG

Alterada: AUGCCAGGUUUUGUGGCAUAG

Repare que aqui estamos modificando duas trincas inteiras. Sendo assim, estaríamos modificando dois aminoácidos.

 

– Troca de duas bases em uma trinca, três bases em outra trinca e uma base em outra trinca, como mostrado abaixo:

Normal: AUGGCCCCAUUUGUGGCAUAG

Alterada: AUGGCCCGUAAACUGGCAUAG

Repare que modificamos duas bases na trinca CCA, que passou a ser CGU. Depois modificamos toda a trinca UUU, que passou a ser AAA. Por fim, modificamos uma base na terceira trinca, que de GUG passou a ser CUG. Se alteramos três trincas, poderíamos alterar três aminoácidos.

 

4) Letra D: diz que houve 9 substituições. Neste caso, teríamos as seguintes possibilidades:

– Mudança de três códons inteiros, como mostrado abaixo:

Normal: AUGGCCCCAUUUGUGGCAUAG

Alterada: AUGCAAGGUAAAGUGGCAUAG

Repare que modificamos três códons inteiros: GCC por CAA, CCA por GGU e UUU por AAA. Neste caso, como mudamos três códons, poderíamos ter alteração de três aminoácidos.

 

– Mudança de duas bases em um códon, dois códons inteiros e uma base em outro códon:

Normal: AUGGCCCCAUUUGUGGCAUAG

Alterada: AUGGGGGGUAAACUGGCAUAG

Repare que mudamos duas bases na primeira trinca (GCC para GGG). Em seguida, mudamos dois códons inteiros (CCA por GGU e UUU por AAA) e, por fim, mudamos a primeira base de um códon (GUG por CUG). Neste caso, alteramos quatro códons e, portanto, podemos alterar quatro aminoácidos.

Essa seria a lógica de resolução desta questão, considerando a ocorrência de substituições e que sempre ocorreria mudança nos aminoácidos. Sendo assim, a resposta correta seria letra D. Contudo, repare que disse que necessitaríamos considerar que sempre haveria troca do aminoácido. Porque falei isso? O código genético é degenerado, ou seja, um mesmo aminoácido pode ser codificado por várias trincas (códons), de modo que podem ocorrer mudanças na sequência que não alteram o aminoácido. Essa seria outra razão que dificulta a resolução da questão.

Em função dessas dificuldades, a universidade optou por anular esta questão. Analisando-a com calma, acredito que a intenção da universidade era abordar um tipo específico de alteração no DNA, que envolve os processos de inserção e deleção.

A inserção ou a deleção de um único nucleotídeo é capaz de provocar uma alteração completa na sequência de códons no RNAm. Observe abaixo: 

– Inserção de um nucleotídeo:

Normal: AUGGCCCCAUUUGUGGCAUAG

Alterada: AUGUGCCCCAUUUGUGGCAUAG

Repare que coloquei uma base U logo depois do códon AUG. Essa única inserção modificará toda a sequência de códons. Na sequência normal, os códons seriam: AUG, GCC, CCA, UUU, GUG, GCA e UAG. Na sequência alterada, os códons seriam: AUG, UGC, CCC, AUU, UGU, GGC e AUA. Sendo assim, poderíamos estar alterando todos os aminoácidos que vem depois da mutação.

 

– Deleção de um nucleotídeo:

Normal: AUGGCCCCAUUUGUGGCAUAG

Alterada: AGGCCCCAUUUGUGGCAUAG

Repare que deletei a base U presente no códon AUG. Essa deleção alterará toda a ordem dos códons nessa sequência. A sequência normal tinha os códons: AUG, GCC, CCA, UUU, GUG, GCA e UAG. A sequência alterada apresentará os códons: AGG, CCC, CAU, UUG, UGG e CAU.

Anúncios
comentários
  1. gabriela disse:

    Me ajudou bastante …

Deixe um comentário

Preencha os seus dados abaixo ou clique em um ícone para log in:

Logotipo do WordPress.com

Você está comentando utilizando sua conta WordPress.com. Sair /  Alterar )

Foto do Google+

Você está comentando utilizando sua conta Google+. Sair /  Alterar )

Imagem do Twitter

Você está comentando utilizando sua conta Twitter. Sair /  Alterar )

Foto do Facebook

Você está comentando utilizando sua conta Facebook. Sair /  Alterar )

Conectando a %s