Arquivo de junho, 2014

A copa do mundo está rolando em nosso país, mas não podemos perder o foco. Estudar é preciso, para que tenhamos êxito em alcançar nossos objetivos. Hoje, trazemos a resolução da prova da 1ª fase da FUVEST aplicada em 2012, que pode ser encontrada no link abaixo:

http://www.fuvest.br/vest2012/1fase/fuv2012v.pdf

 

RESOLUÇÃO COMENTADA

12) Esta questão aborda as funções das organelas celulares, especificamente do complexo de golgi. Esta organela apresenta duas funções essenciais: secreção celular e endereçamento de moléculas. A primeira função relaciona-se com a necessidade que a célula possui de secretar (liberar) substâncias, sejam lipídios, proteínas, hormônios, etc. A segunda função está relacionada à capacidade que tal organela possui de endereçar as substâncias produzidas pela célula ao seu local de atuação. Por exemplo, o retículo endoplasmático rugoso pode produzir uma proteína que atua na membrana plasmática. Então, o retículo produzirá tal proteína e o complexo de golgi irá recebê-la e endereçá-la à membrana plasmática. O mesmo poderá ocorrer se a proteína atuar em outra região da célula. Tal regra também é válida para os lipídios. Sendo assim, a resposta correta é a letra A.

Para que não haja erros em questões relacionadas às funções das organelas, basta seguirmos as informações apresentadas na tabela abaixo:

Imagem

DICA PARA O VESTIBULAR!

A quantidade de cada uma dessas organelas pode variar em função da célula estudada. Por exemplo, uma célula que precise de grande quantidade de energia para o desempenho de suas atividades, como, por exemplo, os espermatozoides, poderá apresentar grande quantidade de mitocôndrias (responsáveis pela produção de energia). Outro exemplo é a célula hepática. O fígado participa do metabolismo de álcool e outras substâncias; por conta disso, possui grande quantidade de retículo endoplasmático liso e de peroxissomos.

 

13) Esta questão exige conhecimento sobre a resposta imunológica. Em primeiro lugar, devemos nos recordar que a resposta imune é o mecanismo de defesa do organismo contra agentes invasores. O organismo dos seres vivos é capaz de reconhecer “corpos estranhos” e possui mecanismos para destruí-los. O reconhecimento específico de um dado agente invasor caracteriza um tipo de resposta imune conhecida como resposta imune adquirida ou adaptativa. Neste processo, um grupo de células chamadas apresentadoras de antígenos reconhecem os “corpos estranhos” ou antígenos e apresentam-nos a um tipo específico de glóbulo branco chamado de linfócito T. Os linfócitos T, por sua vez, podem estimular a produção e liberação de anticorpos pelos linfócitos B ou ativar a ação dos macrófagos na fagocitose dos invasores.

No primeiro contato com o antígeno, este processo de reconhecimento e produção de anticorpos leva um tempo maior, permitindo que o invasor se multiplique e provoque a doença. No entanto, após o primeiro contato, o corpo preserva uma parte dos linfócitos T e B, formando um grupo de células conhecidas como células de memória imunológica, que são capazes de reconhecer imediatamente o antígeno no caso de um segundo contato. Sendo assim, a produção de anticorpos é mais rápida a partir do segundo contato com o antígeno. A reação imunológica ao primeiro contato é chamada de RESPOSTA IMUNE PRIMÁRIA, enquanto a reação ao segundo contato é chamada de RESPOSTA IMUNE SECUNDÁRIA. Este é o princípio que explica a razão de termos algumas doenças por uma única vez. Ele também explica o funcionamento de uma VACINA, que é induzir a criação de células de memória imunológica capazes de reconhecer um antígeno a partir de um segundo contato.

Sabendo dos conceitos acima apresentados, podemos analisar as situações propostas na questão:

 – Inicialmente, injetou-se uma dose de proteína A no camundongo. Após quatro semanas, injetou-se uma nova dose de proteína A, juntamente com uma dose de proteína B.

Sendo assim, pede-se para analisar o gráfico e assinalar a afirmativa correta. Ao observarmos o gráfico, vemos que após a primeira injeção de proteína A, a quantidade de anticorpos aumenta até certo nível, como mostrado na curva X. Em seguida, após a injeção das proteínas A e B, vemos uma curva Y de igual formato a curva X e a curva Z, que apresenta concentração de anticorpos muito superior. Repare que na curva X só tínhamos injeção da proteína A; logo, os anticorpos gerados irão combater essa proteína, o que caracteriza a resposta imune primária. Então, deu-se a segunda injeção. Repare que o camundongo já havia tido contato com a proteína A; logo, nesse segundo contato, a produção de anticorpos será muito maior, o que é observado na curva Z, caracterizando a resposta imune secundária a esse antígeno. A curva Y, por sua vez, representa a resposta imune primária contra a proteína B (o camundongo estava tendo o primeiro contato com este antígeno).

Com base nisso, podemos deduzir que a alternativa A é a resposta correta. 

 

14) Esta questão requer conhecimentos sobre dois processos essenciais: acomodação visual e adaptação a claro e escuro. Além disso, exige-se a compreensão das duas estruturas envolvidas nestes processos: cristalino e íris.

– A íris é um disco que dá cor aos olhos e possui uma abertura chamada de pupila (que atua como um diafragma de uma câmera fotográfica). Ela irá controlar a quantidade de luz que penetra no olho. Isso é um importante mecanismo para que o olho se adapte às condições de claro e escuro. Sendo assim, em condições de claridade maior, a íris aumenta, diminuindo a abertura da pupila; em condições de penumbra (menor intensidade luminosa), por sua vez, a íris diminui, provocando o aumento da abertura da pupila.

Ao analisarmos a questão, vemos que se pergunta o que ocorrerá com a íris quando uma pessoa passa para um ambiente de penumbra. Por estar no escuro, a íris diminuirá, provocando uma maior abertura da pupila. Analisando as alternativas, vemos que somente as letras B, C e E apresentam tal resposta.

Agora devemos analisar a questão da acomodação visual, que é responsabilidade do cristalino:

– O cristalino é uma lente transparente, que recebe a luz que penetrou através da pupila e é responsável pela focalização da imagem. No caso de imagem ou objetos próximos, os músculos ciliares contraem-se e tornam o cristalino mais arredondado, aumentando seu poder de refração; quando se fala em objetos mais distantes (visão de longa distância), os músculos ciliares relaxam e tornam a lente mais alongada.

No enunciado da questão fala-se em objetos próximos. Portanto, os músculos ciliares estarão contraídos, aumentando o poder de refração do cristalino.

Sendo assim, a resposta correta é a letra B.

 

15) Para resolver esta questão, devemos recordar qual a taxonomia das plantas e as principais características de cada grupo de vegetais. Para isso, iremos utilizar a tabela abaixo:

Imagem

Agora, podemos resolver a questão sem maiores dificuldades:

– A primeira afirmativa diz que o grupo evolutivamente mais antigo possui fase haploide mais duradoura que a diploide. De acordo com a tabela, os mais antigos são as briófitas e possuem a característica mencionada. Logo, afirmativa I correta.

– A segunda afirmativa diz que os grupos que possuem fase diploide mais desenvolvida, possuem também raiz, caule e folhas verdadeiros. Os grupos com fase diploide predominante são as Pteridófitas, Gimnospermas e Angiospermas e realmente todos possuem estes órgãos. Logo, a afirmativa II está correta.

– A terceira afirmativa fala em grupos de plantas que possuem fase haploide e diploide de igual duração. Isso não é observado nos grupos de vegetais terrestres. Logo, a afirmativa III está errada. Outro tópico errado é o fato de dizer que esses vegetais possuem rizoides, cauloides e filoides (raiz, caule e folhas não verdadeiros). Vimos na tabela acima, que apenas as briófitas possuem esta característica e as mesmas possuem fase haploide predominante.

Sabendo que as afirmativas I e II estão corretas, a alternativa que responde a questão é a letra D. 

 

16) O enunciado da questão apresenta uma série de eventos que ocorrem durante a multiplicação (divisão) celular. E pede-se para indicar quais eventos estão relacionados com a separação equitativa do material genético. Para isso, devemos diferenciar os processos de mitose e meiose. Repare que a meiose possui duas divisões, a meiose I e a meiose II. A meiose II é rigorosamente igual ao processo de mitose. Então, apresentaremos uma tabela comparando a mitose e a meiose I:

Imagem

Para resolver esta questão, devemos avaliar qual tipo de divisão celular está sendo mencionado. Repare que fala-se em reparação tecidual. Este processo deve-se a ocorrência da mitose, um processo em que as células-filhas possuem a mesma quantidade de material genético que a célula-mãe. Então, devemos nos perguntar: “Das quatro afirmativas apresentadas quais delas estão relacionadas com a mitose e com a separação equitativa do material genético?”. Se analisarmos com atenção, veremos que somente as afirmativas II e IV estão relacionadas com a mitose. Logo, a resposta correta é a letra B.

 

DICAS IMPORTANTES ABAIXO!

ImagemImagem

 

 

17) Esta questão aborda temas mais relacionados com geografia, envolvendo conhecimento sobre características de vegetação e clima das regiões apresentadas no mapa. Ao analisarmos o mapa, podemos verificar que os bandeirantes partiam do estado de São Paulo, que é caracterizado pela presença da Mata Atlântica na região mais litorânea e por grandes áreas de florestas densas.

Sabendo disso, podemos dizer que o ponto de partida eram áreas de florestas mais densas. Logo, podemos eliminar as alternativas A e E, visto que elas consideram que São Paulo não é formado por áreas florestais e nem por florestas mais densas.

Em seguida, devemos avaliar a vegetação característica dos estados de destino: Minas Gerais, Goiás e Mato Grosso. O estado do Mato Grosso é caracterizado pela presença do Pantanal e possui uma área componente da Amazônia Legal. Goiás e Minas Gerais possuem áreas extensas de cerrado, que caracterizam-se pela vegetação com menor quantidade de árvores e altamente esparsa. Sabendo disso, podemos eliminar a alternativa B.

Por fim, precisamos analisar a questão das estações secas e do período de chuvas. Com relação a isso, podemos dizer que era bastante variável, alternando períodos mais secos, como, por exemplo, o inverno no Mato Grosso e certas épocas em Goiás com períodos de chuva intensa, que são observadas sobretudo no estado do Mato Grosso.

Sendo assim, a resposta correta é a letra D.

 

18) Esta questão envolve conhecimentos sobre os ácidos nucleicos e código genético. É importante lembrarmos quais as diferenças entre o DNA e o RNA:

Imagem

Analisando a molécula apresentada na questão, vemos que ela possui uracila (U). Portanto, trata-se de uma molécula de RNA. Sendo assim, somente as alternativas D e E podem estar corretas.

Agora precisamos determinar quantos aminoácidos são encontrados entre o sítio de iniciação e o sítio de mutação. Para isso, devemos nos recordar do seguinte conceito:

“O código genético é representado por trincas de nucleotídeos, ou seja, cada trinca de letras apresentada indica um aminoácido.”

 Então, vamos analisar a situação. O sítio de iniciação da tradução é representado sempre pela trinca AUG. Então, precisamos verificar quantas trincas existem entre AUG e a mutação. Ao fazermos isso, verificamos que existem 24 nucleotídeos (letras) e, portanto, teremos oito trincas. Se há oito trincas, teremos também oito aminoácidos. Sendo assim, a resposta correta é a letra D.

 

19) Esta questão aborda a genética, enfatizando o estudo da herança de duas características ao mesmo tempo (diibridismo). As características estudadas são: a altura das plantas e a cor do fruto.

De acordo com Mendel, cada característica será determinada por um par de genes. Como a questão não menciona nenhuma letra para representar cada característica, consideraremos os genes A e a para a altura da planta e os genes B e b para a cor do fruto.

Uma vez que fizemos isso, podemos determinar quais os genótipos possíveis para cada característica. Repare que o enunciado diz que a característica planta alta é dominante. Logo, as plantas altas possuirão o gene dominante e serão AA ou Aa; as plantas anãs, por sua vez, serão aa. Agora observe que a característica frutos vermelhos é dominante também. Logo, os frutos vermelhos possuirão o gene dominante e serão BB ou Bb; os frutos amarelos, por sua vez, serão bb.

Então, devemos analisar o que o enunciado nos diz. Ele fala que um agricultor cruzou linhagens puras de plantas altas/frutos vermelhos com plantas anãs/frutos amarelos. Mas o que é mesmo uma linhagem pura?

“Linhagens puras de organismos são aquelas obtidas por autofecundação, em que os indivíduos só possuem cópias de um mesmo gene, ou seja, possuem dois genes dominantes (AA ou BB) ou dois genes recessivos (aa).” 

Então, vamos pensar: “Qual o genótipo de linhagens puras de plantas altas com frutos vermelhos? E das plantas anãs com frutos amarelos?”. Se estamos falando em linhagens puras, as plantas altas com frutos vermelhos deverão possuir só cópias de genes dominantes, visto que a característica é dominante. Logo, seu genótipo será AABB. Com relação às plantas anãs com frutos amarelos, podemos dizer que elas só possuirão genes recessivos. Portanto, seu genótipo será aabb.

Após isso, diz-se que o agricultor pretendia obter uma linhagem de plantas anãs com frutos vermelhos e, para isso, permitiu que os descendentes do cruzamento acima apresentado (AABB x aabb) cruzassem entre si, obtendo-se 320 plantas. Então, pergunta-se quantas plantas da linhagem desejada foram obtidas e o cruzamento que se deve fazer para sempre obter as plantas da linhagem desejada.

Para resolver isso, precisamos, em primeiro lugar, descobrir quais os descendentes do primeiro cruzamento (AABB x aabb). Para isso, iremos realizar o cruzamento separado de cada par de genes AA x aa e também BB x bb.

 

– Cruzamento AA x aa

Imagem

– Cruzamento BB x bb

 Imagem

Repare que no cruzamento AABB x aabb produzimos 100% de indivíduos AaBb. Agora, devemos cruzar dois indivíduos AaBb entre si, para que possamos descobrir quantas plantas anãs e de fruto vermelho foram formadas. Para isso, vamos realizar o cruzamento de cada par de genes separadamente:

 

– Cruzamento Aa x Aa

Imagem

– Cruzamento Bb x Bb

 Imagem

Então, devemos verificar qual a probabilidade de formar plantas anãs (aa) e com frutos vermelhos (BB ou Bb) separadamente. No primeiro cruzamento, vemos que apenas um indivíduo formado de um total de quatro possui a característica planta anã; logo, a probabilidade de formarmos plantas anãs é de 1/4. No segundo cruzamento, vemos que três indivíduos formados de um total de quatro possuem a característica frutos vermelhos; logo, a probabilidade de formamos plantas com frutos vermelhos é ¾. Como descobrir a probabilidade de possuir ambas as características? Basta multiplicarmos as probabilidades individuais, como mostrado abaixo:

P (plantas anãs com frutos vermelhos)= P(plantas anãs) x P(frutos vermelhos)

P(plantas anãs com frutos vermelhos)= ¼ x 3/4 = 3/16

Sabendo que a probabilidade é igual a 3/16 e que este cruzamento gerou 320 descendentes, podemos descobrir quantas dessas plantas são anãs e com frutos vermelhos. Basta multiplicarmos, o número total de descendentes pela probabilidade:

3/16 x 320= 60 indivíduos com plantas anãs e frutos vermelhos.

Sabendo disso, somente as alternativas D ou E podem estar corretas.

Agora devemos avaliar qual cruzamento produz plantas anãs com frutos vermelhos. Para obtermos sempre plantas anãs e com frutos vermelhos, precisamos cruzar sempre plantas homozigotas recessivas com relação à altura das plantas (aa) e homozigotas dominantes com relação à cor do fruto (BB). Sendo assim, a resposta correta é a letra E. 

 

20) Esta questão aborda a temática do crescimento das plantas que faz referência à fisiologia vegetal. Para resolvê-la, devemos nos recordar das condições necessárias ao crescimento do vegetal.

As plantas são organismos autótrofos e, portanto, são capazes de produzir seu próprio alimento por meio da fotossíntese. Para tal, a planta necessita de luz, água e gás carbônico. Ao analisarmos as duas situações apresentadas na questão, plantas no algodão e plantas em um vaso, podemos verificar que essas condições são obedecidas nos dois casos. Contudo, a planta também necessita de uma série de micronutrientes, somente encontrados no solo, para completar o seu desenvolvimento. Sendo assim, as plantas presentes no algodão não conseguiriam crescer devidamente e, provavelmente, irão morrer devido à falta desses nutrientes.

Sabendo disso, podemos dizer que a única alternativa que apresenta uma resposta coerente com o que foi mencionado acima é a letra B.

  

21) A questão aborda a evolução dos vertebrados, que estão divididos em cinco grupos: peixes, anfíbios, répteis, aves e mamíferos. Vamos analisar cada afirmativa e discuti-las separadamente:

– Alternativa A: o grupo mais recente de vertebrados são os mamíferos. A passagem dos alimentos por estômago e intestino já é observada em outros grupos, como os répteis e as aves. Portanto, tal afirmação é incorreta.

– Alternativa B: a circulação sofreu modificações ao longo da evolução dos vertebrados. Uma mudança marcante foi a alteração na quantidade de cavidades cardíacas (peixes possuem somente duas cavidades, anfíbios e alguns répteis possuem três cavidades, enquanto os crocodilianos, aves e mamíferos possuem quatro cavidades). Contudo, somente nos grupos dos crocodilianos, aves e mamíferos é que a circulação sistêmica é completamente separada da circulação pulmonar (não há mistura de sangue venoso com sangue arterial). Sendo assim, tal afirmação está incorreta.

– Alternativa C: a respiração celular manteve-se igual em todos os grupos ao longo da evolução. A única mudança observada é a estrutura responsável pelas trocas gasosas em cada grupo. A maioria dos peixes respira através de brânquias (a exceção são alguns peixes de água doce que são pulmonados). Os anfíbios apresentam como principal forma a respiração pulmonar, mas também são capazes de realizar trocas gasosas através da pele (respiração cutânea). Os répteis, as aves e os mamíferos apresentam respiração pulmonar. Logo, a afirmativa está correta.

– Alternativa D: a excreção é realmente variável nestes grupos. Contudo, o tipo de excreta eliminada por cada grupo irá depender do ambiente onde vivem. A amônia, um resíduo bastante solúvel em água, costuma ser eliminada por peixes e girinos. O ácido úrico, um resíduo pouquíssimo solúvel em água, é eliminado por grupos adaptados à ambientes de clima mais seco (como os répteis e aves). Os mamíferos e anfíbios, por sua vez, eliminam principalmente ureia.  Sendo assim, tal afirmativa está incorreta.

– Alternativa E: os peixes apresentam reprodução dependente de água. Contudo, a transição do meio aquático para o terrestre não envolve a formação de indivíduos totalmente independentes de água para a sua reprodução. Os anfíbios, primeiro grupo de vertebrados terrestres, reproduzem-se na água e seu estágio larvar (o girino) vive na água. Portanto, a alternativa está incorreta.

Sendo assim, a resposta correta é a letra C.

 

22) Esta questão fala sobre o efeito estufa, processo natural responsável pelo aquecimento do planeta. No enunciado, diz-se que uma das consequências desse processo é o aumento da temperatura nos oceanos e pergunta-se o que isso provoca. É importante lembrar que a temperatura afeta a dissolução do oxigênio e do gás carbônico nas águas oceânicas. Contudo, precisamos avaliar as justificativas apresentadas nas alternativas. Para auxiliá-los, lembrem-se:

– Uma redução na dissolução do gás carbônico faz com que o fitoplâncton (algas) captem menor quantidade de gás carbônico e, consequentemente, o efeito estufa se intensifique.

– A redução na dissolução de oxigênio diminuirá a quantidade de oxigênio dissolvido na água, podendo provocar a morte de seres vivos componentes da biota.

Sabendo disso, podemos verificar que a única alternativa que apresenta uma resposta coerente é a letra A.

 

BONS ESTUDOS!!!!

Anúncios

Vamos lá galerinha!!!

O primeiro exame de qualificação da UERJ já passou e agora temos que nos preparar para o segundo exame de qualificação, que será em Setembro. Hoje trago o comentário das questões de Biologia presentes na prova de domingo passado, com direito a um comentário detalhado da questão 41, que deixou muitos alunos confusos com seu enunciado. Felizmente, a questão foi anulada pela universidade. Vamos estudar!

 

30) Esta questão requer conhecimento sobre o processo evolutivo das plantas terrestres. Para resolvê-la, basta termos conhecimento sobre as principais características dos quatro grupos de vegetais.

– Briófitas: são os vegetais mais simples encontrados em ambiente terrestre e caracterizam-se por serem avasculares (não possuem vasos condutores de seiva) e por viverem em ambientes úmidos. Além disso, sua reprodução é dependente de água. Os principais exemplos desse grupo são os musgos, hepáticas e antóceros;

– Pteridófitas: são vegetais vasculares (possuem vasos condutores de seiva) e reprodução dependente de água. As samambaias e avencas são os principais representantes deste grupo;

– Gimnospermas: são vegetais vasculares e possuem sementes e reprodução independente de água. Os pinheiros, encontrados na mata de araucárias, são os principais representantes deste grupo;

– Angiospermas: são vegetais vasculares, que possuem sementes e frutos e reprodução independente de água. As árvores frutíferas são os principais representantes deste grupo.

Tendo em vista as informações acima, podemos dizer que pteridófitas, gimnospermas e angiospermas formam um grupo de vegetais chamados vegetais vasculares, pois possuem tecidos condutores de seiva. Além disso, gimnospermas e angiospermas, formam um grupo chamado de fanerógamas, pois possuem sementes e reprodução independente de água.

Sabendo disso, podemos analisar o cladograma. A característica A está presente em todos os grupos de vegetais terrestres. A característica B está presente somente em pteridófitas, gimnospermas e angiospermas. A característica C, por sua vez, está presente somente em gimnospermas e angiospermas. Sabendo disso, podemos deduzir que as características B e C são, respectivamente, a presença de tecidos vasculares e a presença de sementes. Ao analisarmos as alternativas, vemos que só o item D apresenta tal resposta e, portanto, é a resposta correta.

 

31) Esta questão poderia ser resolvida do ponto de vista da química ou da biologia. O enunciado fala sobre a queima de combustíveis fósseis e seus impactos sobre a intensidade do efeito estufa e pergunta-se qual óxido ácido seria o principal responsável por esse processo. Do ponto de vista da biologia, basta lembrar que o CO2 é o principal gás responsável pelo aquecimento do planeta. Do ponto de vista da química, basta lembrar que o processo de combustão completo produz, geralmente, gás carbônico e água.

 

35) Esta questão aborda o tópico sobre osmorregulação em peixes. Para resolvê-la, vamos compreender a situação apresentada na questão. O enunciado fala sobre espécies de peixes que vivem em água doce, mas que conseguem sobreviver mesmo em condições nas quais a salinidade está mais elevada. Analisemos como estará a concentração de sais em um peixe de água doce:

“Em água doce, a concentração de sais é relativamente baixa, de modo que os peixes que vivem nesse ambiente apresentam maior concentração de sais no interior das suas células, ou seja, o meio da água doce é hipotônico (menos concentrado) em relação ao interior das células dos peixes.”

Se a concentração de sais é maior no interior das células, a tendência é que haja entrada de água nas células do peixe, provocando um aumento no volume celular. Para compensar essa entrada excessiva de água, os peixes de água doce tendem a formar grande quantidade de urina, para eliminar esse excesso de água.

Agora vamos analisar a situação apresentada na questão: diz-se que um rio sofreu um processo de salinização, ou seja, houve aumento na concentração de sais e que o peixe responde eliminando mais urina e reabsorvendo mais sais. Se o animal está eliminando mais urina, ele estará eliminando mais água. Com isso, podemos dizer que, por eliminar mais água, o animal estará em um meio com concentração mais elevada. Ao analisarmos as alternativas, vemos que o trecho Y é aquele que apresenta maior concentração de sais e também não está muito distante da concentração original. Logo, a resposta correta é o item C.

  

37) Esta questão poderia ser resolvida tanto pela química quanto pela biologia. No enunciado, fala-se sobre um tipo de interação química que é responsável pelo pareamento de bases no DNA. Com essa informação, devemos nos perguntar qual tipo de interação química é responsável pela união da dupla fita de DNA. A resposta é simples: PONTES DE HIDROGÊNIO. Do ponto de vista da química, bastava lembrarmos que as moléculas de água encontram-se altamente coesas e unidas por conta das pontes de hidrogênio formadas entre elas. Logo, a resposta correta é a letra C.

 

39) O enunciado desta questão fala sobre a presença de membranas interdigitais em embriões de alguns vertebrados. Uma membrana interdigital é um pedaço de tecido localizado entre os dedos, que é observado em algumas espécies adultas, como, por exemplo, em anfíbios aquáticos e algumas aves. No enunciado, diz-se que, em determinado momento do desenvolvimento, o citoplasma da célula libera enzimas que digerem essas membranas. Essa informação é crucial para a resolução da questão. Repare que ele fala em enzimas e digestão. Somente uma organela citoplasmática possui função de digestão intracelular e é conhecida como LISOSSOMO. Logo, a resposta correta é a letra A.

 

41) Esta questão apresenta um tópico que a UERJ tradicionalmente em suas provas, que é a ocorrência de mutações e as possíveis alterações na sequência de aminoácidos de uma proteína. Comentei sobre isso no facebook do blog e também apresentei resoluções de algumas questões sobre tal assunto anteriormente.

O enunciado fala sobre a ocorrência de mutações no RNAm (RNA mensageiro).Lembre-se que mutações são alterações que ocorrem na sequência de DNA e que, consequentemente, podem alterar a o RNAm (produzido a partir de sequências de DNA). Isso seria um erro conceitual da questão.

Ainda no enunciado, diz-se que podem ocorrer substituições simultâneas de bases nitrogenadas adjacentes. Uma substituição é a troca de um nucleotídeo contendo uma dada base nitrogenada por outro nucleotídeo contendo uma base diferente. Sendo assim, a substituição não altera a quantidade de nucleotídeos presentes na sequência de RNAm mensageiro. Essa informação é de grande valia!

Então, pergunta-se qual alternativa apresenta o número de substituições que irá provocar maior alteração na estrutura da proteína formada.

Para alterar a proteína formada, é necessário que haja alteração na sequência de seus aminoácidos, que é determinada pela sequência do RNA mensageiro. Lembre-se que cada trinca de nucleotídeos (cada trinca de letras) do RNAm é chamada de códon e cada uma delas indica um aminoácido específico.

Para compreendermos essa questão e possamos analisá-la, vamos usar uma sequência aleatória:

 

AUGGCCCCAUUUGUGGCAUAG

 

Tendo em vista as informações acima, analisemos cada alternativa:

 

1) Letra A: diz que ocorrem 3 substituições. Se houvessem substituições em três bases adjacentes (que estão uma ao lado da outra), haveriam as seguintes possibilidades:

 – Troca de uma trinca inteira, como mostrado abaixo:

 Sequência normal: AUGGCCCCAUUUGUGGCAUAG

Sequência alterada: AUGCAACCAUUUGUGGCAUAG

Repare que trocamos um códon inteiro. Então, se trocamos um códon, poderíamos trocar um aminoácido.

 

– Troca de dois nucleotídeos numa trinca e um nucleotídeo em outra trinca, como mostrado abaixo:

Normal: AUGGCCCCAUUUGUGGCAUAG

Alterada: AUGGCCCCAUGGCUGGCAUAG

Repare que trocamos duas bases na trinca UUU, que passou a ser UGG. E trocamos uma base na trinca GUG, que passou a ser CUG. Neste caso, poderíamos trocar até dois aminoácidos.

 

2) Letra B: diz que ocorre 4 substituições. Neste caso, teríamos duas possibilidades:

– Troca de uma trinca inteira e mais uma base em outra trinca, como mostrado abaixo:

Normal: AUGGCCCCAUUUGUGGCAUAG

Alterada: AUGCAAGCAUUUGUGGCAUAG

Repare que aqui podemos trocar uma trinca inteira (GCC por CAA) e mais uma base de outra trinca (CCA por GCA). Neste caso, estamos alterando até dois códons e, portanto, poderíamos modificar dois aminoácidos.

 

-Troca de duas bases em um códon e outras duas bases em outro códon:

Normal: AUGGCCCCAUUUGUGGCAUAG

Alterada: AUGGGGGGAUUUGUGGCAUAG 

Repare que aqui poderia estar trocando GCC por GGG (mudei duas bases C por G) e CCA por GGA (mudei duas bases C por G). Neste caso, estou alterando dois códons e, portanto, poderia mudar dois aminoácidos.

 

3) Letra C: diz-se que ocorre 6 substituições nas bases adjacentes. Com isso, teríamos as seguintes possibilidades:

– Troca de dois códons inteiros, como mostrado abaixo:

Normal: AUGGCCCCAUUUGUGGCAUAG

Alterada: AUGCCAGGUUUUGUGGCAUAG

Repare que aqui estamos modificando duas trincas inteiras. Sendo assim, estaríamos modificando dois aminoácidos.

 

– Troca de duas bases em uma trinca, três bases em outra trinca e uma base em outra trinca, como mostrado abaixo:

Normal: AUGGCCCCAUUUGUGGCAUAG

Alterada: AUGGCCCGUAAACUGGCAUAG

Repare que modificamos duas bases na trinca CCA, que passou a ser CGU. Depois modificamos toda a trinca UUU, que passou a ser AAA. Por fim, modificamos uma base na terceira trinca, que de GUG passou a ser CUG. Se alteramos três trincas, poderíamos alterar três aminoácidos.

 

4) Letra D: diz que houve 9 substituições. Neste caso, teríamos as seguintes possibilidades:

– Mudança de três códons inteiros, como mostrado abaixo:

Normal: AUGGCCCCAUUUGUGGCAUAG

Alterada: AUGCAAGGUAAAGUGGCAUAG

Repare que modificamos três códons inteiros: GCC por CAA, CCA por GGU e UUU por AAA. Neste caso, como mudamos três códons, poderíamos ter alteração de três aminoácidos.

 

– Mudança de duas bases em um códon, dois códons inteiros e uma base em outro códon:

Normal: AUGGCCCCAUUUGUGGCAUAG

Alterada: AUGGGGGGUAAACUGGCAUAG

Repare que mudamos duas bases na primeira trinca (GCC para GGG). Em seguida, mudamos dois códons inteiros (CCA por GGU e UUU por AAA) e, por fim, mudamos a primeira base de um códon (GUG por CUG). Neste caso, alteramos quatro códons e, portanto, podemos alterar quatro aminoácidos.

Essa seria a lógica de resolução desta questão, considerando a ocorrência de substituições e que sempre ocorreria mudança nos aminoácidos. Sendo assim, a resposta correta seria letra D. Contudo, repare que disse que necessitaríamos considerar que sempre haveria troca do aminoácido. Porque falei isso? O código genético é degenerado, ou seja, um mesmo aminoácido pode ser codificado por várias trincas (códons), de modo que podem ocorrer mudanças na sequência que não alteram o aminoácido. Essa seria outra razão que dificulta a resolução da questão.

Em função dessas dificuldades, a universidade optou por anular esta questão. Analisando-a com calma, acredito que a intenção da universidade era abordar um tipo específico de alteração no DNA, que envolve os processos de inserção e deleção.

A inserção ou a deleção de um único nucleotídeo é capaz de provocar uma alteração completa na sequência de códons no RNAm. Observe abaixo: 

– Inserção de um nucleotídeo:

Normal: AUGGCCCCAUUUGUGGCAUAG

Alterada: AUGUGCCCCAUUUGUGGCAUAG

Repare que coloquei uma base U logo depois do códon AUG. Essa única inserção modificará toda a sequência de códons. Na sequência normal, os códons seriam: AUG, GCC, CCA, UUU, GUG, GCA e UAG. Na sequência alterada, os códons seriam: AUG, UGC, CCC, AUU, UGU, GGC e AUA. Sendo assim, poderíamos estar alterando todos os aminoácidos que vem depois da mutação.

 

– Deleção de um nucleotídeo:

Normal: AUGGCCCCAUUUGUGGCAUAG

Alterada: AGGCCCCAUUUGUGGCAUAG

Repare que deletei a base U presente no códon AUG. Essa deleção alterará toda a ordem dos códons nessa sequência. A sequência normal tinha os códons: AUG, GCC, CCA, UUU, GUG, GCA e UAG. A sequência alterada apresentará os códons: AGG, CCC, CAU, UUG, UGG e CAU.