CÓDIGO GENÉTICO X SÍNTESE DE PROTEÍNAS

Publicado: 5 de agosto de 2013 em Genética

Um dos tópicos mais comumente abordados nos exames de qualificação da UERJ é a relação entre o código genético e a síntese de proteínas.

RELEMBRANDO…

Se recordarmos tal assunto, teremos algumas informações essenciais:

– A informação genética está contida no DNA das nossas células. Tal informação poderá ser transcrita, produzindo uma molécula de RNA mensageiro. Esta, por sua vez, poderá ser traduzida, produzindo uma proteína. Sendo assim, as características genéticas apresentadas por uma dada espécie (ou mesmo indivíduo) se deve à produção de proteínas.

– Mas como a célula consegue determinar a sequência correta de aminoácidos de cada proteína a partir do RNA mensageiro? A resposta é simples. O código genético é um código de trincas. Nesse caso, cada trinca de nucleotídeos (códons) presentes no RNAm indicará um determinado aminoácido, como apresentado abaixo:

Mas a maioria das questões relacionadas com este assunto abordam a ocorrência de mutações (alterações na sequência de nucleotídeos no DNA e, consequentemente, no RNAm) e questionam se haverá troca de aminoácidos na estrutura das proteínas. Para resolver este tipo de questão, devemos lembrar de outro ponto importante:

“O código genético é degenerado.”

A afirmação acima indica que um mesmo aminoácido pode ser codificado por vários códons. Por exemplo, a alanina pode ser codificado por quatro códons distintos: GCA, GCU, GCG e GCC. Sendo assim, mutações poderão ocorrer, sem provocar mudança no aminoácido codificado.

Para vermos esta aplicabilidade, vamos analisar uma questão da UERJ sobre esse assunto:

 

1) (UERJ -2005)

A mutação em um gene, por conseqüência da substituição de uma única base na estrutura do DNA, pode acarretar modificações importantes na atividade biológica da proteína codificada por esse gene. Considere que a estrutura normal de um RNA mensageiro de um peptídio e sua estrutura alterada em virtude da troca de uma única base no gene correspondente são:

5’ AUGUGGUUUGCACACAAAUGAUAA 3’ (normal)
5’ AUGUGGUUUGAACACAAAUGAUAA 3’ (alterada)

A tabela abaixo identifica alguns códons.

Observe que:
– o códon da metionina é também o do início da tradução;
– os códons de término da tradução são UAA, UAG e UGA.

O aminoácido encontrado no peptídio normal e aquele que o substituiu no peptídio mutante são, respectivamente:
(A) lisina e cisteína
(B) treonina e triptofano
(C) alanina e ácido glutâmico
(D) fenilalanina e ácido aspártico

COMENTÁRIOS

Nesta questão, é abordada a ocorrência de uma determinada mutação. Para que o aluno possa identificá-la, o enunciado as sequência de RNAm normal e alterada. Após isso, o enunciado fornece uma tabela contendo os principais códons e seus respectivos aminoácidos. Essas são as informações que permitirão a resolução da questão.

Após isso, devemos verificar qual a pergunta da questão. Nesse caso, ele pergunta: “Qual o aminoácido é encontrado na proteína normal e na alterada? A resolução é simples. Sabemos que os aminoácidos são codificados por trincas de nucleotídeos. Logo, basta verificarmos quais os códons encontrados em cada sequência (normal e alterada). Quando você analisar estas sequências, verificará que a sequência normal possui um códon GCA, enquanto a sequência alterada possui um códon GAA. Uma vez que sabemos onde ocorreu a mutação e quais os códons normal e alterado, basta buscarmos a informação na tabela. Sendo assim, verificamos que GCA é um códon que indica alanina, enquanto GAA indica ácido glutâmico. Logo, a resposta será letra C.

Por fim, é importante ressaltar que diversas questões com enunciado e resolução similar a esta, tem sido abordadas nos exames qualificatórios da UERJ. Até a próxima!

 

 

 

Anúncios

Deixe um comentário

Preencha os seus dados abaixo ou clique em um ícone para log in:

Logotipo do WordPress.com

Você está comentando utilizando sua conta WordPress.com. Sair /  Alterar )

Foto do Google

Você está comentando utilizando sua conta Google. Sair /  Alterar )

Imagem do Twitter

Você está comentando utilizando sua conta Twitter. Sair /  Alterar )

Foto do Facebook

Você está comentando utilizando sua conta Facebook. Sair /  Alterar )

Conectando a %s