Arquivo de agosto, 2013

Agora vamos resolver algumas questões sobre metabolismo energético!

 

QUESTÃO 1

No esquema abaixo estão representadas as etapas finais do processo fermentativo em células musculares quando submetidas a condições de baixa disponibilidade de oxigênio.

Imagem

 

Considere agora o processo fermentativo do fungo Saccharomyces cerevisiae, ou levedo de cerveja. Neste processo, no lugar do lactato, a substância final formada será:

 (A) etanol

(B) glicose

(C) glicerol

(D) sacarose

 

COMENTÁRIOS:

Essa questão é bastante direta. Seu enunciado fala sobre o processo de fermentação láctica, informando em qual circunstância ele irá ocorrer (prática de atividade física intensa). A pergunta, por sua vez, se refere ao processo de produção de cerveja. Para resolvê-la, basta se lembrar do processo de fermentação alcoólica, realizado pelos fungos. Vimos que este processo produz ETANOL e GÁS CARBÔNICO. Logo, a resposta será alternativa A.

 

QUESTÃO 2

A quantidade total de glicose consumida pelo atleta foi de 0,5 mol. Dessa quantidade, 80% produziram somente ácido lático, e o restante foi completamente oxidado no ciclo dos ácidos tricarboxílicos. O volume de CO2, em litros, nas CNTP, produzido pelas mitocôndrias dos músculos do atleta, corresponde a:

(A) 0,10

(B) 2,24

(C) 6,72

(D) 13,44

 

COMENTÁRIOS:

Ao ler uma questão deste tipo, o aluno se assusta bastante, pois é uma questão de Bioquímica. Vamos ver como resolvê-la?

Primeiro ponto: a questão fala sobre o metabolismo de glicose.

Em seguida, o enunciado menciona a produção de ácido láctico; vamos buscar relembrar o que estudamos sobre essa substância. Busque em sua memória: “Em qual processo produzimos o ácido láctico?”. Se você pensou em FERMENTAÇÃO LÁCTICA, está perfeitamente correto.

Após isso, vamos observar que o enunciado cita o ciclo dos ácidos tricarboxílicos. Mas que palavrão é esse? Acalme-se! Esse cara é ninguém mais ninguém menos que o CICLO DE KREBS.

Agora que já estamos cientes sobre o que a questão aborda, vamos começar a trabalhar com os dados numéricos apresentados no enunciado. O enunciado apresenta duas informações deste tipo:

– Diz que são consumidos 0,5 mols pelo atleta;

– Diz que 80% dessa glicose produziu somente ácido láctico.

Agora, vamos nos perguntar: “Qual a conclusão que podemos tirar a partir destes dados?”.

Observe o seguinte: se 80% desta glicose produzirá ácido láctico, basta calcularmos quanto é 80% de 0,5 mol, para que possamos saber quanto de glicose estará envolvido neste processo. Após essa conta, vamos achar uma resposta igual a 0,4 mols. Então, podemos concluir que 0,4 mols de glicose produzirão ácido láctico e que o restante (0,1 mols de glicose) será completamente oxidado pelo ciclo de Krebs.

Agora vocês precisarão se recordar de alguns conceitos da química:

– Em uma dada equação química, os coeficientes estequiométricos indicam uma proporção entre as substâncias. Sendo assim, na equação geral da respiração celular, apresentada abaixo,podemos concluir que 1 mol de glicose completamente oxidada no ciclo de Krebs produzirá 6 mols de gás carbônico.

Se 1 mol de glicose produz 6 mols de gás carbônico, 0,1 mols de glicose utilizados na questão produzirão 0,6 mols de gás carbônico.

Agora devemos relembrar outro conceito da química:

– Em condições normais de temperatura e pressão (CNTP), o volume ocupado por 1 mol de um gás será igual a 22,4 L.

Sendo assim:

 1 mol de gás carbônico  – 22,4 L

0,6 mol de gás carbônico – x

 Logo, o valor de X será igual a 13,44. Desse modo, a resposta correta é alternativa D.

 

QUESTÃO 3

Para estudar o metabolismo dos organismos vivos, isótopos radioativos de alguns elementos, como o carbono 14, foram utilizados como marcadores de moléculas orgânicas. Podemos demonstrar, experimentalmente, utilizando a glicose marcada com o carbono 14, o acúmulo de produtos diferentes da glicólise na célula muscular, na presença ou na ausência de um inibidor da cadeia respiratória mitocondrial. Em presença desse inibidor, o metabólito radioativo que deve acumular-se no músculo é o ácido denominado:

(A) lático

(B) cítrico

(C) pirúvico

(D) glicérico

 

COMENTÁRIOS

Outra questão que o enunciado parece relativamente complicado, mas que apresenta resolução simples. Lembre-se que a produção de energia poderá ocorrer em condições AERÓBIAS ou ANAERÓBIAS.

Em condições aeróbias, o oxigênio estará presente e grande parte da energia será produzida durante a última etapa, chamada de cadeia respiratória.

Em condições anaeróbias, por sua vez, a produção de energia ocorrerá somente pela glicólise, que é seguida por um processo de FERMENTAÇÃO LÁCTICA (recicla o NAD, que é essencial para a glicólise).

Agora vamos analisar a pergunta apresentada. O enunciado diz que a célula muscular foi colocada na presença e ausência de um inibidor de cadeia respiratória e ele pergunta qual ácido se acumulará no músculo na presença do inibidor.

Vamos raciocinar juntos: “Se colocarmos um inibidor de cadeia respiratória, o que irá acontecer?”. A resposta é simples: a cadeia respiratória será bloqueada, impedindo a síntese de ATP na mitocôndria.

Agora vamos pensar:”Se a síntese de ATP na mitocôndria está bloqueada, qual será a única fonte de energia da célula?”. Se você pensou em GLICÓLISE E FERMENTAÇÃO LÁCTICA, está correto.

LEMBRE-SE!!!! Em condições anaeróbias, o músculo realizará glicólise e fermentação láctica.

Por fim, para responder a questão, pense: “Qual substância é produzida na fermentação láctica?”. A resposta é ÁCIDO LÁCTICO. Logo, a resposta é letra A.

 

QUESTÃO 4

A ciência da fisiologia do exercício estuda as condições que permitem melhorar o desempenho de um atleta, a partir de fontes energéticas disponíveis.

A tabela a seguir mostra as contribuições das fontes aeróbia e anaeróbia para geração de energia total utilizada por participantes de competições de corrida, com duração variada e envolvimento máximo do trabalho dos atletas.

Imagem

Observe o esquema abaixo, que resume as principais etapas envolvidas no metabolismo energético muscular.

Imagem

Ao final da corrida de 400 m, a maior parte da energia total dispendida por um recordista deverá originar-se da atividade metabólica ocorrida nas etapas de números:

(A) 1 e 3

(B) 1 e 4

(C) 2 e 4

(D) 2 e 5

 

COMENTÁRIOS

Esta é uma típica questão sobre o metabolismo energético muscular. Embora apresente grande quantidade de informações possui resolução simples.

No quadro apresentado no início da questão estão disponíveis as informações sobre o percentual de produção de energia relacionado à processos aeróbios ou anaeróbios no caso de diferentes modalidades de atletismo.

Para resolver, vamos verificar qual informação será necessária na resolução da questão. Repare que, no enunciado da pergunta, ele cita a corrida de 400 m. Então, vamos ver na tabela qual a principal fonte de energia no caso desta corrida. Se vocês observarem a tabela com atenção, poderão verificar que 70% da energia é obtida por mecanismos anaeróbios (sem oxigênio), enquanto somente 30% são oriundos de fontes aeróbias.

A partir desta informação, poderemos chegar à resposta correta. Vamos relembrar novamente que, em condições anaeróbias, a célula produz energia por meio da glicólise, que é seguida por um processo de fermentação (recicla o NAD, essencial para a glicólise). Então, vamos analisar o esquema apresentado na questão.

– Qual etapa representa o processo de glicólise? Basta lembrarmos o conceito de glicólise, que é a quebra de uma molécula de GLICOSE em duas moléculas de piruvato. Logo, a etapa 1 representa a glicólise. Sabendo disso, podemos eliminar as alternativas C e D.

– Qual etapa representa um processo de fermentação? Basta lembrarmos que existem dois tipos de fermentação: a alcoólica, que converte piruvato em etanol e gás carbônico, e a láctica, que converte piruvato em lactato. Sabendo disso, pergunto a vocês: “Qual processo de fermentação está representado no esquema e por qual número?”. Se você respondeu que a etapa 3 representa a fermentação láctica, está perfeitamente correto.

Sendo assim, as etapas que ocorrem no caso da corrida de 400 m são: 1 e 3. Logo, a alternativa correta é a letra A.

 

Façam bom proveito e até a próxima!!

Anúncios

Então galerinha,

Até o momento falamos sobre alguns aspectos muito importantes desse tema. Mas outro tópico bastante abordado é a ocorrência dos processos de FERMENTAÇÃO.

Em primeiro lugar, precisamos nos perguntar: 

“Em qual circunstância a célula realiza fermentação?”

A resposta é simples: em condições anaeróbias (ausência de oxigênio).

Vocês devem estar se perguntando: “Mas professor, o senhor não falou no post anterior que a glicólise produz energia em condições anaeróbias?”.

Exatamente!!! A glicólise é responsável por produzir energia em condições anaeróbias. Contudo, para que este processo possa ocorrer, é necessária a disponibilidade de NAD (aceptor de prótons e elétrons). Isso mesmo!!! O NAD não é um recurso inesgotável. Durante as reações de oxidação da glicólise e do ciclo de Krebs, o NAD é convertido em NADH. Na última etapa da respiração celular (fosforilação oxidativa), este NADH será convertido novamente em NAD, que será reutilizado na glicólise e no ciclo de Krebs. Repare que, na respiração celular (condições AERÓBIAS), o NAD é renovado na última etapa. Aí pergunto a vocês:

E EM CONDIÇÕES ANAERÓBIAS? COMO O NAD É RECICLADO, SE NÃO HÁ FOSFORILAÇÃO OXIDATIVA?

A resposta é bem simples: o NADH é convertido em NAD pelos processos de fermentação. Sendo assim, a fermentação recicla o NAD, que poderá ser utilizado na glicólise, para a produção de energia (ATP).

Outro ponto essencial bastante abordado em provas de vestibular são os tipos de fermentação. Vamos falar sobre eles?

De modo geral, existem dois tipos de fermentação:

ALCOÓLICA: 

O piruvato produzido na glicólise é convertido em ETANOL e GÁS CARBÔNICO.

Agora vamos olhar algumas curiosidades que são cobradas em vestibular. Tentem responder as duas perguntas abaixo:

1. Por que a massa de pão cresce quando a deixamos descansando?

2. Por que a cerveja e o vinho contém álcool?

E aí já pensou? Parecem perguntas bastante complexas, mas possuem explicações bastante simples. Então, vamos discuti-las:

O preparo do pão utiliza fermento biológico, que é um tipo de fungo. Na ausência de oxigênio, este fungo realiza FERMENTAÇÃO ALCOÓLICA e produz gás carbônico. O acúmulo deste gás na massa faz ela aumentar de tamanho.

No caso da cerveja e do vinho, utiliza-se um fungo (levedura) que, na ausência de oxigênio, também realiza fermentação alcoólica e produz ETANOL (álcool comum). Sendo assim, o álcool presente nessas duas bebidas não foi adicionado em nenhum momento, mas sim formado durante a fermentação.

Talvez vocês já tenham ouvido falar que quanto mais velho for o vinho, maior será o seu valor; isso se deve ao fato do vinho ter fermentado por maior período de tempo. Mas isso tem um limite de tempo e condições específicas. Em determinadas condições, o vinho pode se oxidar e gerar vinagre.

 

LÁCTICA 

O piruvato produzido na glicólise é convertido em LACTATO ou ÁCIDO LÁCTICO.

Este processo está bastante relacionado com a realização de atividades físicas intensas por seres humanos. Para compreender isso, vamos imaginar um cara jogando futebol e tentar responder à seguinte pergunta:

Como estará o suprimento de oxigênio no músculo dessa pessoa? 

Vamos pensar: “Se estou praticando atividade física, a demanda de energia será maior ou menor?”. É óbvio que será maior, pois suas células musculares estarão “trabalhando” muito mais. Então: “Será que a demanda por oxigênio será maior ou menor?”. Também será maior, visto que o oxigênio é essencial para a respiração celular. 

Agora, vamos refletir: “Será que a nossa respiração e a circulação sanguínea consegue suprir toda a demanda por oxigênio nestas situações?”. A resposta é simples: NÃO. Então, como fazer para produzir energia?

Você já sabe responder. Comentamos isso em outro post. Em condições anaeróbias, nosso corpo produzirá energia por meio da glicólise. E realizará a FERMENTAÇÃO LÁCTICA com o objetivo de reciclar o NAD, que é essencial para que a glicólise ocorra.

Imagem

 

BOM ESTUDO A TODOS!!! Em breve resolução de questões sobre o assunto.

Até o momento falamos sobre conceitos importantes deste assunto. Agora iremos conversar sobre o principal processo de produção de energia pela célula chamado de RESPIRAÇÃO CELULAR AERÓBIA.

Reparem que menciono um nome que aparece em outros assuntos da biologia: AERÓBIA. Mas o que significa essa palavra? Este termo refere-se ao fato deste processo necessitar de oxigênio para ocorrer. Sendo assim:

 

SEMPRE QUE VOCÊS LEREM A PALAVRA AERÓBIA EM UMA QUESTÃO, DEVERÃO RELACIONAR COM A NECESSIDADE DE OXIGÊNIO PARA O PROCESSO OCORRER!!!!

 

Mas o que é a respiração celular aeróbia?

A resposta é simples. É um processo de produção de energia realizado pelas células de TODOS os seres vivos, que consome oxigênio e produz água e gás carbônico. Além disso, está dividido em três etapas: Glicólise, Ciclo de Krebs e Fosforilação oxidativa.

É importante que você, como vestibulando, compreenda que cada uma destas etapas ocorre em determinado local na célula e apresenta uma característica mais geral. Então, observem a tabela abaixo:

foto1

 

Esta tabela traz informações preciosas para resolver determinadas questões de vestibular. Por exemplo, suponhamos a seguinte situação: “Sob atividade física intensa, o suprimento de oxigênio para as células musculares encontra-se insuficiente.” O que ocorrerá com a célula neste caso? Será incapaz de produzir energia devido a falta de oxigênio?

A resposta é simples: NÃO. Na falta de oxigênio, a célula poderá produzir energia por meio do processo de glicólise que é anaeróbio. Este termo ANAERÓBIO significa que o processo ocorre mesmo na ausência de oxigênio.

Outro ponto que vale ser destacado é o local de ocorrência do Ciclo de Krebs e da Fosforilação oxidativa. Estes dois processos ocorrem no interior de uma organela específica chamada de MITOCÔNDRIA. Muitos alunos erram questões relacionadas a este tópico devido a essa informação. A presença de organelas é uma característica EXCLUSIVA de células eucariontes. Sendo assim, em protistas, fungos, plantas e animais, estes processos ocorrem nas mitocôndrias. Então, vocês devem estar se perguntando: “E nas bactérias, que são procariontes? Onde ocorrem esses processos?”. A resposta é simples:

 

EM BACTÉRIAS, AS TRÊS ETAPAS DA RESPIRAÇÃO CELULAR OCORREM NO CITOPLASMA E A FOSFORILAÇÃO OXIDATIVA ESTÁ RELACIONADA COM A MEMBRANA PLASMÁTICA.

 

Em se tratando deste assunto, é raro o primeiro exame de qualificação da UERJ e outras provas de vestibular (como, por exemplo, ENEM, FUVEST e Unicamp) cobrarem detalhes bioquímicos sobre as etapas deste processo. Muitas provas abordam conceitos relacionados à glicólise e aos processos fermentativos (que serão discutidos no próximo post). Então, enfatizarei brevemente alguns pontos importantes sobre estas etapas.

 

1. GLICÓLISE

É essencial que vocês compreendam o que ocorre em termos gerais durante a glicólise. Sendo assim, precisam ter o conceito de que A GLICÓLISE É A QUEBRA DE UMA MOLÉCULA DE GLICOSE PRODUZINDO DUAS MOLÉCULAS DE PIRUVATO (ou ácido pirúvico). Lembre-se: entra glicose e sai piruvato.

Outro ponto a ser destacado é que a glicólise apresenta um baixo rendimento energético: produz apenas 2 moléculas de ATP. Essa é uma importante diferença em relação aos processos aeróbios (ciclo de Krebs e fosforilação oxidativa), que juntos produzem em média 30 a 32 moléculas de ATP.

foto 3.jpg

 

2. CICLO DE KREBS

Para aqueles que não farão exame discursivo de Biologia, é importante ter uma visão geral sobre esta etapa. Este ciclo se caracteriza por uma série de reações de oxidação e redução e produz NADH, FADH2, ATP e gás carbônico.

 

3. FOSFORILAÇÃO OXIDATIVA

É a última etapa da respiração celular e envolve dois processos básicos:

– Cadeia transportadora de elétrons

– Síntese de ATP

Para entender essa etapa, vamos refletir sobre os eventos das etapas anteriores. Houve pouca produção de ATP na glicólise e no ciclo de Krebs. Contudo, devido às reações de oxidação e redução, houve produção de quantidades significativas de NADH e  FADH2. Então, vamos refletir:

“Qual a importância de capturar os elétrons gerados nas etapas anteriores?”

A resposta é simples: estes elétrons participarão indiretamente da síntese de ATP nesta última etapa. Em linhas gerais, o NADH e o FADH2 irão transferir os elétrons para moléculas presentes na mitocôndria (estarão se oxidando). Estes elétrons, por sua vez, serão transportados ao longo de uma cadeia chamada de CADEIA TRANSPORTADORA DE ELÉTRONS OU CADEIA RESPIRATÓRIA. Ao longo desse transporte, será liberada energia, que será utilizada para a síntese de ATP nesta etapa.

 

foto 3

 

BOM ESTUDO  TODOS!!!! Amanhã tem mais.

PS: se as imagens estiverem pequenas, é só clicar nelas para visualizar melhor o seu conteúdo.

Uma vez que conhecemos as fontes de energia, é necessário conhecer os processos de produção de energia. Mas primeiro é necessário ter compreendido alguns conceitos. 

Aqui, utilizarei algumas perguntas para discutir estes conceitos. Então, vamos às perguntas:

 

1. De onde vem a energia presente nos nutrientes?

“A energia extraída dos nutrientes encontra-se armazenada em suas ligações químicas. Lembre-se que as moléculas de nutrientes são formadas pelo arranjo e ligação entre átomos de diferentes elementos químicos (geralmente carbono, hidrogênio e oxigênio). Desse modo, cada uma dessas ligações contém uma dada quantidade de energia, que é liberada quando ela é quebrada.”

 

2. O que ocorre com a energia liberada pela quebra das ligações químicas nas moléculas de nutrientes?

Esta energia será armazenada em uma molécula chamada ATP (adenosina trifosfato). O ATP possui três ligações fosfato de alta energia (armazenam grande quantidade de energia, como indicado na figura abaixo:

Imagem

 

Como vocês podem ver na figura acima, a quebra de uma ligação fosfato irá liberar energia e produzirá uma molécula de ADP (adenosina difosfato).

Então, NÃO SE ESQUEÇAM que a energia fica estocada em nossas células sob a forma de ATP e sua quebra produz ADP. Este, por sua vez, poderá ser utilizado para produzir mais ATP.

 

3. Mas quando uma molécula de ATP será quebrada por nossas células?

Mediante a necessidade de uso de energia para alguma atividade da célula. Por exemplo, durante a transmissão de impulsos nervosos por neurônios, durante a contração muscular, para o transporte ativo de substâncias através da membrana plasmática, etc.

 

Um assunto bastante abordado nas provas dos principais vestibulares do país é o METABOLISMO ENERGÉTICO das células. Muitos alunos apresentam dificuldades na compreensão deste tema em função de sua relação com a química. Então, vamos tentar descomplicar este tópico? 

Na preparação para o vestibular, é necessário focarmos nos principais tópicos dentro de cada tema específico. Em se tratando de metabolismo energético, os principais conceitos envolvem a ideia de processos aeróbios e anaeróbios (respiração celular e fermentação), etapas da respiração celular, tipos de fermentação e fontes de energia.

Então, neste post, vamos iniciar nossa discussão pelas fontes de energia. Desse modo, pergunto: “O que pode ser utilizado como fonte de energia pelos seres vivos?”

Muitos de vocês já devem ter ouvido falar sobre a necessidade de ingerir alimentos, pois estes serão os “combustíveis” de nosso corpo. A ideia é exatamente essa. Os alimentos são formados por diversos nutrientes que podem ser utilizadas para a produção de energia. 

Agora vamos pensar: “Quais nutrientes presentes nos alimentos fornecem energia?”. A resposta é bem simples: três tipos de nutrientes fornecem energia, que são os CARBOIDRATOS, os LIPÍDIOS e as PROTEÍNAS. 

ImagemEstes três nutrientes fornecem energia para o corpo. Contudo, serão utilizados em momentos distintos. Os carboidratos, também chamados de açúcares ou glicídios, são as fontes primárias de energia para as nossas células, ou seja, representam a principal fonte de energia do organismo. Para exemplificarmos a importância destas moléculas, podemos mencionar o caso de neurônios e hemácias, que utilizam apenas carboidratos como fonte de energia. Os lipídios e proteínas, por sua vez, representam reservas de energia e geralmente são utilizados como fonte de energia em condições de jejum ou mesmo atividade física intensa. Por exemplo, muitos de vocês já devem ter ouvido falar no termo “queimar gordurinhas” (bastante utilizado em academias); isso significa que a prática da atividade física irá fazer com que o organismo utilize os lipídios armazenados como fonte de energia.

CÓDIGO GENÉTICO X SÍNTESE DE PROTEÍNAS

Publicado: 5 de agosto de 2013 em Genética

Um dos tópicos mais comumente abordados nos exames de qualificação da UERJ é a relação entre o código genético e a síntese de proteínas.

RELEMBRANDO…

Se recordarmos tal assunto, teremos algumas informações essenciais:

– A informação genética está contida no DNA das nossas células. Tal informação poderá ser transcrita, produzindo uma molécula de RNA mensageiro. Esta, por sua vez, poderá ser traduzida, produzindo uma proteína. Sendo assim, as características genéticas apresentadas por uma dada espécie (ou mesmo indivíduo) se deve à produção de proteínas.

– Mas como a célula consegue determinar a sequência correta de aminoácidos de cada proteína a partir do RNA mensageiro? A resposta é simples. O código genético é um código de trincas. Nesse caso, cada trinca de nucleotídeos (códons) presentes no RNAm indicará um determinado aminoácido, como apresentado abaixo:

Mas a maioria das questões relacionadas com este assunto abordam a ocorrência de mutações (alterações na sequência de nucleotídeos no DNA e, consequentemente, no RNAm) e questionam se haverá troca de aminoácidos na estrutura das proteínas. Para resolver este tipo de questão, devemos lembrar de outro ponto importante:

“O código genético é degenerado.”

A afirmação acima indica que um mesmo aminoácido pode ser codificado por vários códons. Por exemplo, a alanina pode ser codificado por quatro códons distintos: GCA, GCU, GCG e GCC. Sendo assim, mutações poderão ocorrer, sem provocar mudança no aminoácido codificado.

Para vermos esta aplicabilidade, vamos analisar uma questão da UERJ sobre esse assunto:

 

1) (UERJ -2005)

A mutação em um gene, por conseqüência da substituição de uma única base na estrutura do DNA, pode acarretar modificações importantes na atividade biológica da proteína codificada por esse gene. Considere que a estrutura normal de um RNA mensageiro de um peptídio e sua estrutura alterada em virtude da troca de uma única base no gene correspondente são:

5’ AUGUGGUUUGCACACAAAUGAUAA 3’ (normal)
5’ AUGUGGUUUGAACACAAAUGAUAA 3’ (alterada)

A tabela abaixo identifica alguns códons.

Observe que:
– o códon da metionina é também o do início da tradução;
– os códons de término da tradução são UAA, UAG e UGA.

O aminoácido encontrado no peptídio normal e aquele que o substituiu no peptídio mutante são, respectivamente:
(A) lisina e cisteína
(B) treonina e triptofano
(C) alanina e ácido glutâmico
(D) fenilalanina e ácido aspártico

COMENTÁRIOS

Nesta questão, é abordada a ocorrência de uma determinada mutação. Para que o aluno possa identificá-la, o enunciado as sequência de RNAm normal e alterada. Após isso, o enunciado fornece uma tabela contendo os principais códons e seus respectivos aminoácidos. Essas são as informações que permitirão a resolução da questão.

Após isso, devemos verificar qual a pergunta da questão. Nesse caso, ele pergunta: “Qual o aminoácido é encontrado na proteína normal e na alterada? A resolução é simples. Sabemos que os aminoácidos são codificados por trincas de nucleotídeos. Logo, basta verificarmos quais os códons encontrados em cada sequência (normal e alterada). Quando você analisar estas sequências, verificará que a sequência normal possui um códon GCA, enquanto a sequência alterada possui um códon GAA. Uma vez que sabemos onde ocorreu a mutação e quais os códons normal e alterado, basta buscarmos a informação na tabela. Sendo assim, verificamos que GCA é um códon que indica alanina, enquanto GAA indica ácido glutâmico. Logo, a resposta será letra C.

Por fim, é importante ressaltar que diversas questões com enunciado e resolução similar a esta, tem sido abordadas nos exames qualificatórios da UERJ. Até a próxima!

 

 

 

VAMOS DISCUTIR AGORA UMA QUESTÃO SOBRE SÍNTESE DE PROTEÍNAS

Questão 34

As características abaixo são referentes aos processos de replicação, transcrição e tradução, que ocorrem em seres vivos.

I – A síntese de proteínas tem início antes mesmo do término da transcrição.
II – A grande maioria dos genes contém íntrons, retirados antes da tradução.
III – A síntese de proteínas sempre ocorre em ribossomos livres no citoplasma.
IV – O processo de replicação possui uma única origem.
As características I, II, III e IV estão associadas, respectivamente, aos organismos indicados em:
(A) eucariotos – eucariotos – procariotos – eucariotos
(B) eucariotos – procariotos – eucariotos – procariotos
(C) procariotos – eucariotos – procariotos – procariotos
(D) procariotos – procariotos – eucariotos – procariotos

 

COMENTÁRIOS

Para a resolução desta questão é necessário conhecermos os conhecimentos de procariotos e eucariotos. Se relembrarmos este tópico, verificaremos que as células procariotas apresentam como características a ausência de carioteca e de organelas citoplasmáticas, enquanto as células eucariotas apresentam carioteca e organelas citoplasmáticas. Essas informações podem ser utilizadas no julgamento das afirmativas apresentadas.

O item I afirma que a síntese de proteínas (tradução) ocorre mesmo antes do término da transcrição. Nas células eucariotas, estes dois processos são separados espacialmente, ou seja, a transcrição ocorre no núcleo e a tradução ocorre no citoplasma. Desse modo, em eucariotos, há também uma separação temporal destes processos. Nas células procariotas, por sua vez,  estes dois processos ocorrem no citoplasma. Sendo assim, é possível que a transcrição e a tradução ocorram concomitantemente. 

O item II fala sobre a presença de íntrons no DNA. Neste ponto, é importante que vocês se recordem da existência de dois tipos de sequências: íntrons e éxons. Os íntrons são sequências não-codificantes, ou seja, contém informações que não participam da síntese de proteínas e, portanto, são removidos antes do processo de tradução. Eles estão presentes EXCLUSIVAMENTE em células eucariotas. 

O item III fala sobre o local onde ocorre a síntese de proteínas. Neste caso, vocês deverão se recordar das aulas de citoplasma, onde foi estudado que a síntese de proteínas em eucariotos ocorre em uma organela citoplasmática específica chamada de RETÍCULO ENDOPLASMÁTICO RUGOSO (contém ribossomos aderidos em sua superfície). Sendo assim, a característica apresentada é observada em células PROCARIOTAS, que possuem ribossomos livres no citoplasma.

O item IV fala sobre o processo de replicação do DNA. De todos os itens apresentados, este é o mais atípico de ser abordado em provas de vestibulares. Neste caso, é importante vocês saberem que a replicação é o processo de duplicação do DNA, que ocorre antes de uma célula se dividir. Além disso, é importante vocês saberem que, em CÉLULAS PROCARIOTAS, há uma única origem de replicação.

Sendo assim, a resposta é letra C.

 

DICA!!!

Fiquem atentos na resolução das questões, pois, muitas vezes, não há a necessidade de saber julgar todas as afirmativas para chegar à resposta correta. Por exemplo, quando verificamos que o item I é referente aos procariotos, podemos eliminar as alternativas A e B. Quando julgamos o item II e verificamos que ele se refere às células eucariotas, já podemos concluir que a resposta é letra C, não havendo necessidade de julgar os itens seguintes.

Outra dica importante na resolução deste tipo de questão é tentar julgar sempre os itens que você apresenta maior conhecimento, para minimizar as chances de um erro.

No primeiro exame de qualificação do vestibular 2014 da UERJ, tivemos uma prova pouco abrangente em termos de variedade de conteúdos. Contudo, a prova manteve a característica marcante de abordar tópicos, como, por exemplo, a síntese de proteínas e o metabolismo energético; este último, diretamente relacionado com a atualidade, visto que aborda as mortes provocadas por intoxicação com cianeto e monóxido de carbono, que ocorreram durante o incêndio na Boate Kiss na cidade de Santa Maria-RS.

ENTÃO, VAMOS DISCUTIR AS QUESTÕES ABORDADAS NESSE EXAME?

Neste post, vamos discutir a primeira questão de biologia apresentada na prova.

QUESTÃO 30

 

LAUDOS CONFIRMAM QUE TODAS AS MORTES NA BOATE KISS OCORRERAM PELA INALAÇÃO DE FUMAÇA

Necrópsia das 234 vítimas daquela noite revela que todas as mortes ocorreram devido a inalação de gás cianídrico e de monóxido de carbono gerados pela queima do revestimento acústico da boate (Adaptado de ultimosegundo.ig.com.br, 15/03/2013).

Os dois agentes químicos citados no texto, quando absorvidos, provocam o mesmo resultado: paralisia dos músculos e asfixia, culminando na morte do indivíduo. Com base nessas informações, pode-se afirmar que tanto o gás cianídrico quanto o monóxido de carbono interferem no processo denominado:

(A) síntese de DNA

(B) transporte de íons

(C) eliminação de excretas

(D) metabolismo energético

 

COMENTÁRIO:

Essa é uma questão clássica de metabolismo energético de uma célula e podemos utilizar diferentes informações de seu enunciado para resolvê-la.

Em primeiro lugar, fique atento aos sintomas característicos (paralisia muscular e asfixia) da intoxicação pelos gases mencionados no enunciado. Esta informação é bastante relevante, pois permite realizar uma associação entre a asfixia e o efeito destes gases. Se pensarmos no significado do termo asfixia, provavelmente iremos relacioná-lo com a dificuldade de respirar. Baseado nesta ideia, podemos associar que a dificuldade respiratória irá dificultar a obtenção de oxigênio, uma vez que a obtenção deste gás é a principal finalidade da respiração. Por fim, devemos nos perguntar, em qual função do corpo o oxigênio atua; neste momento, você deverá se recordar que o oxigênio é essencial para a produção de energia no corpo (participa da respiração celular). Logo, a resposta é letra D. 

Contudo, se esta informação sobre a asfixia não fosse mencionada no enunciado, como poderíamos resolver esta questão?

Neste caso, seria necessário conhecer os efeitos do gás cianídrico e do monóxido de carbono em nosso corpo.O gás cianídrico afeta a ocorrência da respiração celular, atuando como inibidor da cadeia respiratória; ele impede o transporte de elétrons ao longo da cadeia respiratória, bloqueando a produção de ATP (energia) pela célula. O monóxido de carbono, por sua vez, se liga à molécula de hemoglobina (proteína responsável pelo transporte de oxigênio no corpo) e impede que o oxigênio se ligue a ela; desse modo, o transporte de oxigênio ficará prejudicado, o que o impedirá de chegar até às células, que não conseguirão produzir energia.

Se analisarmos atentamente, ambos os gases estão afetando a produção de energia pelas células, o que indica que seu efeito é sobre o METABOLISMO ENERGÉTICO. Portanto, a resposta correta é a letra D. 

VESTIBULAR UERJ 2014

Publicado: 4 de agosto de 2013 em Sem categoria

Se liga na Biologia!

Boa noite estudantes,

O Segundo Exame de Qualificação da Universidade do Estado do Rio de Janeiro (UERJ) se aproxima e chega o momento de intensificarmos ainda mais os estudos. A análise dos exames de qualificação aplicados nos últimos anos pela universidade indica uma tendência de abordagem de determinados temas de Biologia em suas provas. Entre estes temas, podemos mencionar: síntese de proteínas, bioquímica (principalmente metabolismo energético, enzimas e proteínas), sistema endócrino (principalmente tireoide, pâncreas e ciclo menstrual) e estudos de DNA e expressão gênica. Sendo assim, estaremos revisando estes tópicos e acrescentando alguns outros tópicos que são cobrados mais esporadicamente nos exames qualificatórios da UERJ, como, por exemplo, a parte de Fisiologia Humana.

VAMOS ESTUDAR QUE AINDA HÁ TEMPO DE CONSEGUIR SE PREPARAR E OBTER UM BOM RESULTADO NA UERJ!!!!!

Ver o post original

VESTIBULAR UERJ 2014

Publicado: 4 de agosto de 2013 em Sem categoria

Boa noite estudantes,

O Segundo Exame de Qualificação da Universidade do Estado do Rio de Janeiro (UERJ) se aproxima e chega o momento de intensificarmos ainda mais os estudos. A análise dos exames de qualificação aplicados nos últimos anos pela universidade indica uma tendência de abordagem de determinados temas de Biologia em suas provas. Entre estes temas, podemos mencionar: síntese de proteínas, bioquímica (principalmente metabolismo energético, enzimas e proteínas), sistema endócrino (principalmente tireoide, pâncreas e ciclo menstrual) e estudos de DNA e expressão gênica. Sendo assim, estaremos revisando estes tópicos e acrescentando alguns outros tópicos que são cobrados mais esporadicamente nos exames qualificatórios da UERJ, como, por exemplo, a parte de Fisiologia Humana.

VAMOS ESTUDAR QUE AINDA HÁ TEMPO DE CONSEGUIR SE PREPARAR E OBTER UM BOM RESULTADO NA UERJ!!!!!