Forças Evolutivas

Publicado: 27 de fevereiro de 2016 em Sem categoria

Na postagem anterior falamos sobre a seleção natural e seus tipos e destacamos sua importância como uma força evolutiva. Entretanto, ela não é a única força evolutiva existente. Existem outros fatores capazes de afetar a variabilidade genética e, consequentemente, a capacidade de adaptação de uma dada espécie ao ambiente onde vive.  Considerando isso, há outras três forças evolutivas essenciais:

a) Deriva Gênica: geralmente ocorre com populações de pequeno tamanho. Em função do tamanho da população, a probabilidade de cruzamento entre indivíduos com grau próximo de parentesco (endocruzamento) se eleva. Considerando o grau de parentesco existente entre os indivíduos integrantes da população, pode-se inferir que eles possuam caracteres genéticos similares ou mesmo idênticos. Desse modo, cruzamentos entre eles provocariam uma redução da variabilidade genética da população, reduzindo sua capacidade de adaptar-se às mudanças no ambiente. As reduções drásticas das populações podem ocorrer em função de eventos, como, por exemplo, desastres ecológicos, incêndios florestais, inundações, etc. Analisemos a figura abaixo. Considere a existência de uma população inicial (com tamanho normal) e variabilidade genética (repare que há indivíduos vermelhos e amarelos). Então, consideremos a ocorrência de um desastre ambiental na área ocupada por essa população; o que ocorrerá com seu tamanho? Repare que a situação B da figura indica uma redução drástica no tamanho da população e uma prevalência maior de indivíduos vermelhos em detrimento dos indivíduos amarelos. O que ocorrerá com essa população após um tempo? Repare que a situação C mostra o que pode vir a ocorrer com a população; ela perderá sua variabilidade genética (repare que restam apenas indivíduos vermelhos). Vale ressaltar que o esquema é simplificado se comparado a uma situação real, haja vista que o desaparecimento de determinada característica pode levar muitos anos para ocorrer. No entanto, em situações de desastre tais eventos podem ocorrer mais rapidamente em função de ter sido provocada por uma alteração extrema no ambiente.

deriva gênica

b) Migração: é um movimento de entrada ou saída de indivíduos de uma determinada população. Estas ações de deslocamento entre populações elevam o fluxo gênico entre populações distintas de uma mesma espécie. Desse modo, a probabilidade de endocruzamento (cruzamento entre parentes) se reduz, favorecendo o aumento da variabilidade genética da população e sua capacidade de adaptação às mudanças no ambiente. Um exemplo clássico da importância do fluxo gênico são os CORREDORES ECOLÓGICOS, que permitem o trânsito de fauna entre populações distintas de uma mesma espécie. Analisemos a figura abaixo, para ilustrar esta questão. Repare que o esquema apresenta três populações distintas (A, B e C), que vivem em territórios distintos. A população A é formada predominantemente por indivíduos vermelhos e poucos amarelos com borda vermelha. A população B é formada predominantemente por indivíduos amarelos com borda vermelha e poucos indivíduos vermelhos. Por fim, a população C é formada somente por indivíduos amarelos. Considere que o cruzamento de indivíduos vermelhos e amarelos produz indivíduos amarelos com borda vermelha, ou seja, trata-se de um caso de codominância, onde o cruzamento entre dois indivíduos (neste, vermelhos e amarelos) produz um fenótipo intermediário (amarelo com bordas vermelhas). O que irá ocorrer se estes indivíduos puderem migrar entre essas populações? Observe no esquema que indivíduos vermelhos podem migrar das populações A e B para a população C, inserindo esta nova característica nesta população. Repare também que indivíduos amarelos (inexistentes na população A) poderão migrar para esta população, inserindo uma nova característica nela. Repare que mesmo a migração de indivíduos amarelos com bordas vermelhas para a população C, pode permitir o aparecimento da característica vermelho nesta população. Com isso, demonstramos que a migração permite o fluxo de genes, aumentando a variabilidade genética das populações.

Migração

c) Mutação: caracteriza-se por uma alteração genética aleatória (ou induzida em alguns casos) na sequência de nucleotídeos existentes no DNA. Devido à alteração em nível de genes, poderá ocorrer alteração no fenótipo do indivíduo. Essa alteração, por sua vez, pode aumentar ou reduzir a capacidade de adaptação do indivíduo às mudanças do ambiente. Um exemplo clássico de mutação desvantajosa (deletéria) é a alteração no gene da hemoglobina humana; indivíduos normais produzem hemoglobina normal e transportam oxigênio; indivíduos que possuem mutação neste gene produzem uma hemoglobina alterada e desenvolvem uma doença chamada anemia falciforme.

 

Bom estudo!!

Anúncios

SELEÇÃO NATURAL

Publicado: 24 de fevereiro de 2016 em Sem categoria

Tema recorrente nos exames de qualificação aplicados pela UERJ em seus últimos vestibulares, a seleção natural e suas relações com a genética, abarcadas pela Teoria Sintética da Evolução, representa um tema bastante relevante de ser compreendido. Neste tópico, discutiremos os principais conceitos e os tipos de seleção natural.

Para iniciarmos nossa discussão, vamos introduzir este conceito. A seleção natural é uma importante força evolutiva, que atua sobre os indivíduos ou grupos, selecionando positivamente os caracteres mais vantajosos (adaptativos) para a sobrevivência da espécie. Para exemplificar:

“Suponhamos a existência de dois grupos de pássaros: um com bicos finos e alongados e o outro com bicos mais largos e robustos. Consideremos que esses pássaros vivam em uma ilha e que cada grupo possua um hábito alimentar específico. Então, suponhamos que a principal fonte de alimento dos pássaros com bicos finos e alongados se torne escassa, devido a uma alteração no ambiente e que o alimento dos pássaros com bicos mais largos e robustos permaneça abundante na área. O que irá ocorrer?”

De acordo com a teoria da seleção natural, os indivíduos que possuem caracteres mais vantajosos, tenderão a sobreviver. Desse modo, em nosso exemplo, os pássaros que possuem bicos mais largos e robustos, que possuem a característica mais adaptada ao ambiente em que vivem e à principal fonte de alimento disponível, tenderão a sobreviver. E o que ocorrerá com os pássaros de bicos finos e alongados? Por possuírem uma característica menos adaptada ao ambiente em que vivem, esta população tenderá a se reduzir gradualmente e poderá vir a desaparecer completamente.   Reparem que Darwin partiu do princípio de que existe diversidade de características entre os indivíduos e espécies, o que conhecemos hoje por VARIABILIDADE GENÉTICA. Ele também considera que esta diversidade de caracteres confere capacidades de adaptação distintas aos indivíduos em função do ambiente em que vivem. O que queremos dizer com isso? Dependendo do ambiente onde o indivíduo é encontrado, uma característica pode ser mais ou menos adaptativa (vantajosa). Por exemplo, um urso polar possui grande quantidade de gordura armazenada em seu tecido adiposo, o que lhe confere uma capacidade elevada de adaptação ao clima frio; mas essa mesma característica seria pouquíssimo vantajosa se ele vivesse em ambientes tropicais (clima quente).

À luz das teorias sobre hereditariedade propostas por Mendel e os avanços nos conhecimentos sobre genética, introduz-se o conceito de FENÓTIPO. Um fenótipo é uma determinada característica observada em um ser vivo. Por exemplo, podemos ter pessoas com olhos castanhos, azuis ou verdes; neste caso, temos três fenótipos distintos (castanhos, azuis ou verdes) para a cor dos olhos. Com relação à cor da pele, podemos ter vários fenótipos distintos: negros, mulatos-escuros, mulatos-médios, mulatos-claros e brancos.

A partir disso, podemos dizer que a Seleção Natural atua sobre os fenótipos apresentados pelos indivíduos ou grupos, selecionando aqueles que conferem maior adaptabilidade a eles. Considerando que, para cada característica existe uma diversidade de fenótipos, a seleção natural seleciona os fenótipos que conferem mais vantagens ao indivíduo na adaptação ao ambiente em que vive.

Sabendo disso, podemos introduzir os conceitos de três tipos de seleção natural:

  1. a) Seleção Estabilizadora: comum em ambientes estáveis, favorecem o aumento das populações dos indivíduos que apresentam fenótipos intermediários. Ex: seres humanos com alturas médias possuem mais aptidão do que indivíduos mais baixos ou mais altos.

Seleção estabilizadora

  1. b) Seleção direcional: ocorre em ambientes onde ocorrem mudanças ambientais, favorecendo apenas um fenótipo extremo. Ex: uma população de presas haja indivíduos com três cores diferentes: branca, cinza-claro e cinza-escuro. Imagine que essa população viva em um ambiente claro, coberto por gelo e neve, por exemplo. É claro que os indivíduos brancos serão beneficiados pelo ambiente, visto que estarão melhor camuflados e, portanto, protegidos dos predadores. Portanto, a forma extrema branca irá aumentar sua freqüência em detrimento da intermediária cinza-claro ou da outra extrema cinza-escuro.

Seleção direcional

  1. c) Seleção disruptiva: favorecem os indivíduos com fenótipos extremos. Ex: comunidades de pássaros que consumam somente dois tipos de alimentos, larvas de madeira e sementes grandes e duras. Neste caso, somente os pássaros com caracteres extremos (bicos mais finos ou mais largos) conseguiriam obter alimento. Os indivíduos com bicos médios (fenótipo intermediário) não conseguiriam obter alimento e seriam desfavorecidos.

Seleção disruptiva

Vale ressaltar que este assunto de Biologia Evolutiva está completamente agregado à Genética de Populações e que, portanto, a seleção natural afeta os fenótipos, devido a sua ação sobre a freqüência dos genes e respectivos genótipos. Mas isso é assunto pra outra aula! Bom estudo!

 

 

RESOLUÇÃO – PROVA DO ENEM 2014

Publicado: 21 de fevereiro de 2016 em Sem categoria

A partir de hoje começaremos a postar as resoluções das provas anteriores do ENEM. Hoje vamos estudar a prova amarela de 2014, disponibilizada no link abaixo

http://download.inep.gov.br/educacao_basica/enem/provas/2014/CAD_ENEM_2014_DIA_1_02_AMARELO.pdf

Vamos começar a trilhar o caminho para o sucesso!!!!

 

48) A resolução desta questão requer a simples análise da figura apresentada em seu enunciado. Para auxiliá-los na compreensão, analisemos cada uma das etapas representadas na figura:

– 1ª Etapa: isolamento de DNA bacteriano, ou seja, a informação genética da bactéria foi devidamente extraída e isolada, de modo que a mesmo pudesse ser utilizada posteriormente;

– 2ª etapa: clonagem do DNA. Esta etapa envolve a produção de várias cópias do DNA bacteriano isolado, por meio de técnicas de duplicação in vitro. É simples compreender esta etapa! Basta lembrar que clones possuem materiais genéticos rigorosamente idênticos!

– 3ª etapa: extração do gene de interesse e fabricação do mesmo. Repare que a técnica tem por objetivo trabalhar com um único gene de interesse. Então, por meio do uso de enzimas especiais (chamadas de enzimas de restrição), é possível quebrar o DNA em trechos específicos, de modo a obter apenas o gene de interesse;

– 4ª etapa: inserção do gene nas células do tecido da planta. O gene bacteriano, que foi isolado na etapa anterior, será inserido na célula do tecido da planta, por meio de técnicas específicas. Com isso, este gene poderá se integrar ao DNA da planta. Desse modo, a expressão desse gene pela célula da planta irá produzir a proteína responsável pela resistência a algumas pragas específicas.

Considerando todo o processo exposto acima, devemos nos perguntar: “Qual o produto final da aplicação dessa técnica?”. A resposta é simples: ao aplicar esse método, conseguiu-se produzir uma planta que contém um gene bacteriano, responsável por conferir resistência a pragas. Observe atentamente o detalhe: temos uma espécie de planta contendo um gene de outra espécie (bactéria). Essa técnica em que o gene de uma espécie é inserido no DNA de outras espécies é conhecida como TRANSGENIA. Logo, a planta produzida é transgênica e a resposta correta é a letra E.

 

51) Essa questão tem resolução bastante direta. As células de cordão umbilical, por se tratarem de células embrionárias, são indiferenciadas, ou seja, possuem baixo grau de especialização funcional. Por conta disso, tem potencial para sofrer diferenciação nos diversos tipos celulares encontrados nos tecidos e órgãos humanos. Além disso, possuem alto índice mitótico, ou seja, sofrem divisão celular com bastante freqüência. Considerando essas características, o potencial terapêutico dessas células deve-se à resposta indicada na alternativa D.

 

57) Esta questão envolve a interpretação de heredogramas e a associação com os padrões de herança genética existentes. A análise de qualquer heredograma envolve dois momentos distintos:

– Determinação se o caráter estudado é dominante ou recessivo.

– Determinação se a herança está vinculada aos autossomos (cromossomos não-sexuais) ou cromossomos sexuais (X e Y, no caso da espécie humana).

Tente sempre analisar as alternativas apresentadas e eliminar aquelas totalmente absurdas, que você tem a certeza que não podem ser a resposta certa. Para isso, avalie se há necessidade de uma análise mais detalhada. Então, vamos analisar as alternativas:

– Alternativa A: essa alternativa requer uma análise mais atenta, para que se possa determinar se a herança é realmente dominante e autossômica. Logo, não pode ser eliminada imediatamente;

– Alternativa B: essa alternativa também exige uma análise mais atenta e traz uma informação correta e relevante: quando o pai é doente, os filhos do sexo masculino não apresentam a doença. Sendo assim, temos que analisá-la com mais cuidado;

– Alternativa C: essa alternativa traz informações importantes. Ela afirma que é uma herança ligada ao cromossomo Y. Se nos recordarmos, o cromossomo Y é encontrado exclusivamente em indivíduos do sexo masculino. Logo, se a herança fosse ligada a esse cromossomo, somente os homens poderiam ser afetados. Ao analisar o heredograma, verifica-se que a maioria dos indivíduos afetados é do sexo feminino. Logo, esta alternativa está INCORRETA.

– Alternativa D: essa alternativa também requer análise mais atenta, visto que sua justificativa é facilmente constatada no heredograma; todas as filhas de homens afetados também são afetadas.

– Alternativa E: essa alternativa fala em co-dominância, um caso específico de inexistência de dominância entre genes alelos, que geralmente produz fenótipos intermediários. Contudo, a informação relevante diz respeito à justificativa. Ela fala que a herança é herdada por filhos de ambos os sexos, tanto do pai quanto da mãe. Essa é uma afirmação falsa, visto que a análise do heredograma indica que as filhas herdam a característica tanto do pai quanto da mãe, enquanto os filhos herdam a característica apenas da mãe. Sendo assim, esta alternativa está INCORRETA.

Considerando a análise acima, conseguiu-se excluir duas alternativas (C e E). Então, teremos de analisar as outras três alternativas.

  1. a) Dominante e autossômica
  2. b) Recessiva e ligada ao sexo (ligada ao cromossomo X)
  3. d) Dominante e ligada ao sexo (ligada ao cromossomo X)

Para resolver a questão, vamos escolher um dos casais e fazer a análise para os três casos descritos. Vamos convencionar que os genes A e a sejam os alelos dominante e recessivo para essa característica.

– Analisando o casal da primeira geração (homem normal e mulher afetada):

  1. a) Dominante e autossômica

Se considerarmos que a característica é dominante, uma pessoa sadia apresentaria genótipo aa, enquanto uma pessoa doente possuiria genótipo AA ou Aa. Sendo assim, façamos o cruzamento entre um homem normal e uma mulher afetada.

 

a

a

A

Aa Aa
A Aa

Aa

 

 

a

a

A

Aa

Aa

a aa

AA

Observe que, caso a mulher fosse heterozigota, haveria possibilidade de ter filhos normais e afetados. Sendo assim, a característica descrita no enunciado poderia estar relacionada a uma herança dominante e autossômica. Sendo assim, a alternativa A continua sendo possível.

 

  1. b) Recessiva e ligada ao sexo

Uma herança ligada ao sexo é aquela ligada ao cromossomo X. Vamos convencionar os símbolos XA e Xa para representar os alelos dominante e recessivo, respectivamente. Partindo do pressuposto que seja uma característica recessiva, os genótipos ficariam assim organizados:

Mulher normal

XAXA

Mulher portadora

XAXa

Mulher afetada

XaXa

Homem normal

XAY

Homem afetado

XaY

Considerando o cruzamento de um homem normal (XAY) com uma mulher afetada (XaXa), conforme mostrado abaixo:

 

XA

Y

Xa

XAXa XaY
Xa XAXa

XaY

Observe que desse cruzamento, 50% seriam mulheres portadoras e 50% seriam homens afetados. Ao analisar o heredograma, vemos que isso não é verdadeiro, visto que esse casal teve um filho e uma filha normais. Sendo assim, a alternativa B está INCORRETA.

 

  1. d) Dominante e ligada ao sexo

Vamos convencionar as siglas XA e Xa para representar os alelos dominante e recessivo, respectivamente.

Considerando que a característica é dominante, os genótipos dos indivíduos seriam os seguintes:

Mulher normal

XaXa

Mulher afetada

XAXA ou XAXa

Homem normal

XaY

Homem afetado

XAY

Sendo assim, realizando o cruzamento de um homem normal com uma mulher afetada, teríamos as seguintes possibilidades:

 

Xa

Y

XA

XAXa XAY
XA XAXa

XAY

 

 

Xa

Y

XA

XAXa XAY
Xa XaXa

XaY

Ao analisarmos as duas possibilidades, vê-se que, caso a mulher fosse heterozigota, haveria possibilidade de ter filhos e filhas afetadas e normais. Sendo assim, ainda há possibilidade de que esta alternativa esteja correta.

A análise desse primeiro casal eliminou uma das alternativas e permitiu concluirmos que a característica é dominante, visto que as alternativas restantes indicam isso. Mas como faremos para descobrir se é um caso de herança autossômica ou ligada ao sexo? A resposta é simples: vamos escolher outro casal, a fim de que possamos chegar à conclusão da resposta correta. Como o primeiro casal escolhido envolvia uma mulher afetada e um homem normal, vamos optar por um casal diferente. Neste caso, vamos optar pelo casal da segunda geração, em que o homem é afetado e a mulher normal. Vamos proceder com as análises:

  1. a) Será que a herança é autossômica? Vamos convencionar que as letras A e a representam os alelos dominante e recessivo, respectivamente. Considerando isso, um indivíduo normal possuirá genótipo aa, enquanto o indivíduo afetado poderá apresentar genótipo AA ou Aa. Sendo assim, o cruzamento de um homem afetado com uma mulher normal apresenta o seguinte resultado:
 

A

A

a

Aa Aa
a Aa

Aa

 

 

A

a

a

Aa aa
a Aa

aa

Repare que há dois cruzamentos possíveis, visto que o homem pode ser homozigoto dominante (AA) ou heterozigoto (Aa). Nesse caso, observe que, caso o homem seja heterozigoto, ele poderá ter filhos normais ou afetados, conforme o heredograma.

 

  1. b) Será que a herança é ligada ao sexo? Vamos utilizar o mesmo casal avaliado no exemplo anterior e convencionar que os alelos dominante e recessivo sejam representados pelas siglas XA e Xa. Considerando que trata-se de uma herança dominante, os genótipos dos indivíduos seriam os seguintes:

 

Mulher normal

XaXa

Mulher afetada

XAXA ou XAXa

Homem normal

XaY

Homem afetado

XAY

 

Fazendo o cruzamento de um homem afetado com uma mulher normal teremos as seguintes possibilidades:

 

XA

Y

Xa

XAXa XaY
Xa XAXa

XaY

Analisando o cruzamento, verifica-se que, desse cruzamento, todas as filhas serão afetadas pela característica e todos os filhos serão normais. Ao analisarmos o heredograma, verificamos que tal fato é constatado; todas as filhas desse casal são afetadas, enquanto os filhos são normais.

Considerando isso, vemos que a herança poderia ser dominante ou ligada ao sexo e não chegou-se a uma conclusão final. Então, como resolver esta questão? Tenha atenção com as justificativas apresentadas! A afirmativa A indica que a herança é autossômica dominante, visto que ambos os sexos são afetados; isso não é exclusividade de caracteres autossômicos. Caracteres transmitidos por meio do cromossomo X também podem afetar ambos os sexos. Sendo assim, o caráter estudado na questão é transmitido por herança ligada ao sexo e dominante, indicando que a resposta correta é a alternativa D.

Você deve estar exclamando e discutindo a complexidade da questão. Na verdade, existem alguns macetes para resolvê-las de modo mais rápido. Contudo, achei interessante mostrar que, muitas vezes, a análise de heredogramas requer trabalho e atenção às informações apresentadas e exige análise por meio de tentativa e erro. Para ver alguns dos macetes sobre o tema, visite a publicação sobre análise de heredogramas disponível no nosso site.

 

58) A resolução dessa questão requer conhecimentos sobre o processo digestivo. Sempre que se fala em digestão, sugiro que se tenha conhecimento sobre os principais órgãos onde ocorre a digestão química: boca, estômago e duodeno. O que saber nesse caso? É preciso conhecer os sucos digestivos que atuam em cada órgão, suas principais enzimas, quais nutrientes são digeridos e o pH ideal de ação dessas enzimas. A tabela abaixo resume esses itens:

Órgão Suco digestivo Enzimas Nutriente digerido pH ideal

Boca

Saliva Amilase salivar Amido 7,0

Estômago

Suco Gástrico

Pepsina

Proteínas

2,0 – 3,0

Intestino delgado

Suco entérico

Maltase

Maltose

7,0 – 9,0

Sacarase

Sacarose

Lactase

Lactose

Suco Biliar

Não possui

Emulsifica lipídios

Suco pancreático

Amilase pancreática

Amido

7,0 – 9,0

Lipase pancreática

Lipídios

Tripsina

Proteínas e peptídeos

Repare que a digestão na boca ocorre em pH neutro e digere apenas amido. A digestão no estômago, por sua vez, ocorre em pH ácido e digere apenas proteínas. Por fim, a digestão no intestino delgado ocorre em pH mais básico (alcalino) e digere proteínas, lipídios e amido.

Considerando isso, vamos analisar o enunciado da questão. A desconfiança de que seja uma protease (enzima que digere proteínas) gástrica e que a mesma atua no estômago é uma informação bastante relevante. Se considerarmos a hipótese do pesquisador como verdadeira, deveremos analisar quais as condições ideais de ação de uma enzima no estômago e qual alimento citado é rico no nutriente (proteínas) alvo da ação dessa enzima. Essa resolução é simples: as enzimas estomacais atuam bem em pH mais ácido. Sendo assim, as alternativas A, C e E podem ser descartadas, visto que o pH indicado é básico. Em seguida, basta analisarmos qual dos dois alimentos (pedaço de carne ou macarrão) é rico em proteínas. O macarrão contém grande quantidade de carboidratos, como, por exemplo, amido; as carnes, por sua vez, são alimentos ricos em proteínas. Desse modo, a alternativa correta é a letra B.

 

64) A questão apresentada discute a Teoria da Endossimbiose, que explica a estrutura específica apresentada pelas mitocôndrias e cloroplastos. Essas organelas celulares possuem algumas características peculiares: presença de duas membranas (interna e externa), presença de DNA circular com capacidade própria de replicação e produção de determinadas proteínas, entre outras. A análise da membrana interna das mitocôndrias indicou que as características dessa membrana são bastante similares a organismos procariontes. Além disso, o DNA circular é exclusividade de organismos do Reino Monera, que são procariontes. Essas duas características corroboram a teoria de que as mitocôndrias e os cloroplastos teriam se originado da incorporação de organismos procariontes ancestrais por células mais complexas. Considerando as características expostas, a resposta correta é a alternativa D.

 

67) Essa questão requer conhecimentos sobre tipos sanguíneos. Sua resolução é bastante simples, se considerarmos as seguintes informações:

– O tipo sanguíneo, de acordo com o sistema ABO, pode ser caracterizado pela presença de dois tipos de moléculas: aglutinogênios e aglutininas. Os aglutinogênios são antígenos encontrados na membrana plasmática das hemácias (glóbulos vermelhos) da pessoa e podem ser dos tipos A e B. As aglutininas, por sua vez, são anticorpos encontrados no plasma sanguíneo e podem ser dos tipos Anti-A e Anti-B.

– Cada tipo sanguíneo possui uma combinação de aglutinogênio e aglutinina específica e a análise dessa característica permite a definição do tipo sanguíneo da pessoa. A tabela abaixo apresenta os aglutinogênios e aglutininas encontradas em cada tipo sanguíneo:

Tipo sanguíneo

Aglutinogênio Aglutinina
A A

Anti-B

B

B Anti-A

AB

A e B

O

Anti-A e Anti-B

É importante ressaltar também que o encontro entre aglutinogênio e aglutinina correspondentes, como, por exemplo, aglutinogênio A e aglutinina anti-A, provoca uma reação de aglutinação de hemácias.

Com essas informações, já é possível resolver a questão. Analisemos cada lote apresentado na tabela do enunciado:

  1. a) Lote I: não ocorreu aglutinação na presença de soro anti-A, mas aconteceu aglutinação na presença de soro anti-B. Sendo assim, qual aglutinogênio está presente nesse tipo sanguíneo? Se houve aglutinação com soro anti-B, isso indica a presença do aglutinogênio correspondente, que é o aglutinogênio B. Sabendo disso, este lote possui sangue do Tipo B.
  2. b) Lote II: ocorreu aglutinação apenas na presença de soro anti-A. Isso indica somente a presença de aglutinogênio A. Logo, este lote possui sangue do Tipo A.
  3. c) Lote III: ocorreu aglutinação na presença de ambos os soros (anti-A e anti-B). Isso indica a presença dos aglutinogênios A e B, que é característica de sangue tipo AB.
  4. d) Lote IV: não ocorreu aglutinação na presença de ambos os soros (anti-A e anti-B). Isso indica a ausência de ambos os aglutinogênios no sangue. Essa característica pertence ao sangue tipo O.
  5. e) Lote V: ocorreu aglutinação somente na presença de soro anti-B. Isso indica a presença de aglutinogênio B, caracterizando o sangue do tipo B.

Sabendo que a questão pergunta quantos litros de sangue tipo A estão disponíveis nesses lotes e avaliando as informações que deduzimos acima, somente 25 litros de sangue pertencem a esse tipo sanguíneo (lote II). Logo, a alternativa correta é a letra B.

 

69) Esta questão aborda a temática das cadeias alimentares. O enunciado menciona o caso de insetos parasitoides, cuja característica é o desenvolvimento de suas larvas no interior de um hospedeiro (lagartas). Além disso, menciona-se que a larva leva o hospedeiro à morte, no momento em que se transforma em pupa.

Repare que a lagarta é um animal herbívoro, ou seja, que se alimenta essencialmente de plantas, caracterizando-se como organismos heterótrofos. Os animais que alimentam-se dos produtores (plantas) são chamados de consumidores primários. Sendo assim, uma vez que as larvas se alimentam dos tecidos da lagarta, elas poderão ser caracterizadas como consumidores secundários. Logo, a resposta correta é a alternativa B.

Contudo, duas dúvidas podem surgir nesta questão:

– A alternativa D menciona que as larvas seriam organismos heterótrofos de segunda ordem, que é um termo sinônimo de consumidores secundários. Então, por que esta alternativa está incorreta? Ela menciona que este é o nível mais energético na cadeia alimentar; tal informação é equivocada, visto que parte da energia é perdida ao longo da cadeia alimentar, de modo que os produtores (base da cadeia) sempre representarão o grupo mais energético.

– A alternativa E fala que as larvas atuariam como decompositores, visto que se alimentam dos tecidos da lagarta. Todavia, por que as larvas não são consideradas decompositores? Pelo simples fato de decompositores atuarem sobre matéria orgânica morta.

 

73) A questão trata das interações ecológicas existentes entre os seres vivos, mencionando diversas dessas interações em seu enunciado:

– Bactérias inibem crescimento de fungo causador de doenças no tomateiro, por consumirem o ferro disponível no meio;

– Bactérias fixam nitrogênio, o que auxilia no crescimento do tomateiro;

– Bactérias produzem auxinas, hormônios que estimulam o crescimento do tomateiro;

– Bactérias disponibilizam cálcio, que auxilia no crescimento do tomateiro.

Então, dentre esse rol de interações, questiona-se qual delas representa um caso de competição. Para resolver, basta lembrar que a competição é uma interação desarmônica, ou seja, que envolve prejuízo às espécies envolvidas. Analisando os casos apresentados acima, somente a alternativa C representa um caso de competição, visto que a bactéria e o fungo competem por um mesmo recurso, o ferro disponível no meio.

Competição

Exclusão competitiva

 

74) O enunciado descreve brevemente as características do bioma Cerrado, comum na região Centro-Oeste do Brasil, como lençol freático profundo, estação seca bem marcada, grande insolação e recorrência de incêndios naturais. Então, apresentam-se cinco árvores distintas avaliadas em dois parâmetros: superfície foliar e profundidade das raízes; e questiona-se qual dessas árvores seria ideal para uma ação de reflorestamento nessa região de Cerrado.

A resolução da questão é bastante simples: basta analisar as duas características marcantes do Cerrado: lençol freático profundo e clima seco. Considerando que a disponibilidade de água está em lençóis mais profundos, a árvore deverá possuir raízes de alta profundidade, de modo a conseguir obter água. Com isso, pode-se excluir as árvores 1, 3 e 4, que possuem raízes de baixa profundidade. Considerando o clima seco do Cerrado, deduz-se que as plantas deste bioma devem evitar a perda excessiva de água por meio do processo de transpiração. Sendo assim, uma adaptação comum nessas plantas é o revestimento de sua superfície foliar por um composto que impeça a perda excessiva de água, como, por exemplo, as ceras. Desse modo, a árvore 2 é a ideal para o reflorestamento nessa área. Logo, a resposta correta é a letra B.

Transpiração

 

81) A questão discute a temática de evolução, enfatizando uma polêmica existente sobre a espécie humana ser o ápice do processo evolutivo. Em se tratando desta discussão, tal afirmativa é bastante questionada, haja vista que a mesma indicaria uma estagnação de tal processo. Ao afirmar que o ser humano é o ápice do processo evolutivo, estaríamos considerando que esta espécie seria o “ponto final” na escala evolutiva.

No entanto, se partirmos do pressuposto de que a seleção natural (proposta por Darwin) está em constante ação sobre as diversas espécies de seres vivos e representa uma importante força evolutiva, devemos considerar que caracteres distintos estão constantemente sendo selecionados em função do grau de adaptabilidade ao meio, concedidos às diversas espécies e seus indivíduos. Sendo assim, ao considerar a relevância e atuação da seleção natural no meio, os cientistas consideram que os caracteres se modificam gradualmente. Logo, a resposta correta é a alternativa A.

 

84) Esta questão é de simples resolução. Ao lermos o enunciado, verificamos que os produtores rurais retiraram a ingestão de carne e derivados de sua dieta. Considerando isso, devemos nos questionar: “Qual o principal nutriente fornecido pela carne?”. A resposta é simples: as carnes são alimentos ricos em proteínas, que são biomoléculas formadas por várias moléculas menores conhecidas como aminoácidos. Tendo esse conhecimento, já podemos deduzir que haverá uma redução na quantidade de aminoácidos no organismo dos produtores rurais e, portanto, os mesmos deverão ingerir outros alimentos ricos em aminoácidos. Contudo, ao analisarmos as alternativas, veremos que dois tipos de aminoácidos são apresentados: naturais e essenciais. Como resolver a questão? Basta recordar a diferença entre estes dois tipos de aminoácidos:

– Naturais: são os aminoácidos produzidos pelo próprio organismo;

– Essenciais: aminoácidos não produzidos pelo organismo e que precisam ser obtidos a partir da dieta.

Sendo assim, a resposta correta é a alternativa D.

 

86) Esta questão fala sobre a produção de energia a partir do lixo. Como isso é possível? O lixo acumulado nos aterros sanitários sofre um processo de decomposição por bactérias anaeróbias (vivem na ausência de oxigênio). Considerando que o processo de decomposição ocorre na ausência de oxigênio, o produto final gerado é o gás metano. Sendo assim, a resposta correta é a alternativa D.

 

88) Esta questão fala sobre um grupo de substâncias conhecidas como imunobiológicos e apresenta duas situações distintas, a primeira em seres humanos e a segunda em equinos. Analisemos cada situação:

– Humanos: se analisarem a imagem com atenção, poderão observar que o Imunobiológico I é constituído por vírus ou bactérias que estão sendo aplicados no braço de uma pessoa. Então, para solucionar a questão, basta pensar: “Quais substância é formada por vírus e bactérias e é aplicada em seres humanos?”. A resposta é bastante simples: VACINAS. Estas contêm microrganismos mortos ou inertes, que induzem a produção de anticorpos pelo organismo.

– Equinos: a imagem indica a aplicação do Imunobiológico II em um cavalo, induzindo a produção do Imunobiológico III, que pode ser aplicado em seres humanos. Repare que a imagem mostra um balão, onde uma pessoa se recorda ter sido picada por uma cobra. Essa informação é básica para a resolução da questão. Deve-se questionar: “O que fazer quando uma pessoa é picada por uma cobra ou outro animal venenoso?”. A resposta é simples: aplicação de SORO (antiofídico no caso de picada de cobras). Sabendo disso, podemos deduzir que o imunobiológico III é um soro utilizado nessas circunstâncias. A partir disso, devemos nos questionar: “Qual a composição do soro?”. A resposta é simples: o soro é uma solução formada por anticorpos específicos para o combate aos componentes dos venenos. À medida que temos essa informação, devemos nos perguntar: “Considerando que os anticorpos foram produzidos no corpo do cavalo, o que induziu a produção dos mesmos pelo organismo deste ser vivo?”; a resposta é bastante simples: o Imunobiológico II injetado no cavalo, induziu a produção dos anticorpos.

Considerando as informações construídas acima, pode-se observar que os Imunobiológicos I e II induzem a produção de anticorpos. Logo, a resposta correta é a alternativa D.

Caso tenham maior interesse neste tema, em breve postaremos uma nota sobre sistema imunológico e poderão compreender mais profundamente sobre esse tema frequentemente abordado nas provas do ENEM.

 

VAMOS ESTUDAR!!!

 

2º EXAME DE QUALIFICAÇÃO – UERJ 2015

Publicado: 15 de setembro de 2014 em Sem categoria

Ontem foi dia de prova. A UERJ aplicou seu segundo exame de qualificação e aqui trazemos os comentários das questões de biologia presentes na prova. Fiquem atentos, pois ainda nesta semana começaremos a postar resoluções dos exames discursivos de biologia da UERJ separados por área da biologia. Bons estudos!!!

Acessem o link com a prova de ontem: http://www.vestibular.uerj.br/portal_vestibular_uerj/arquivos/arquivos2015/provas_e_gabaritos/2eq/2015_2eq_prova.pdf

COMENTÁRIOS:

30) Esta questão aborda a relação entre fragmentação de habitat e extinção. Inicialmente, para resolvê-la precisamos compreender estes dois conceitos. A fragmentação de habitat é um processo em que ambientes, anteriormente contínuos, foram sendo fragmentados em manchas menores. Um exemplo clássico é o caso da Mata Atlântica, que antes ocupava praticamente todo o litoral brasileiro e que hoje está restrita a apenas algumas manchas isoladas. O isolamento dos fragmentos, por sua vez, dificulta a migração de indivíduos entre os fragmentos, ou seja, reduz o fluxo de genes entre as populações dos diversos fragmentos. Esse fator associado ao tamanho pequeno das populações presentes nos fragmentos é um grande responsável pela ocorrência de extinções de espécies. Mas por que isso? Em populações de pequeno tamanho, a chance de ocorrer endocruzamento (entre indivíduos geneticamente próximos ou mesmo parentes) é maior. Com isso, a população tende a se uniformizar, ou seja, está sujeita à perda de variabilidade genética. Com isso, as populações perdem sua capacidade de se adaptar melhor às diversas mudanças que ocorrem no ambiente, tornando-se suscetíveis. Então, o risco das espécies se extinguirem torna-se maior. Esse processo em que as populações de tamanho pequeno perdem variabilidade genética e tornam-se mais sujeitas à extinção é chamado de DERIVA GÊNICA. Logo, a resposta correta é a alternativa B.

32) Esta questão fala sobre as características de biomoléculas, como o glicogênio e os lipídios. O glicogênio é um polissacarídeo formado por várias moléculas de glicose e atua como reserva de energia dos animais. Os lipídios, por sua vez, também são importantes reservas energéticas. Então, diz-se que o glicogênio apresenta uma vantagem em relação aos lipídios e pede-se para indicar qual das alternativas apresenta esta vantagem. Inicialmente, duas alternativas podem ser descartadas: a letra B e a letra C. A alternativa B diz que o glicogênio é uma molécula compactada; isso não é verdade, visto que o mesmo apresenta grande tamanho e alto peso molecular. Por outro lado, a alternativa C informa que o glicogênio produz maior quantidade de energia; tal afirmativa também é incorreta, visto que os lipídios são moléculas mais calóricas que os carboidratos; um grama de lipídio contém 9Kcal, enquanto um grama de carboidrato contém apenas 4kcal.

Agora, teremos que comparar as alternativas A e D. A primeira fala sobre o processo de hidrólise (quebra por ação da água), enquanto a segunda menciona a solubilidade em água. Dessas duas alternativas, qual pode representar uma vantagem para a molécula de glicogênio? A resposta é simples: por ser uma molécula mais instável que os lipídios, o glicogênio tem maior capacidade de sofrer hidrólise. Logo, a resposta correta é a alternativa A.

35) Esta questão exige conhecimentos sobre os processos de fotossíntese e respiração celular. O enunciado apresenta o experimento realizado, indicando que uma determinada solução de cor vermelha foi adicionada a 4 tubos de ensaio e que, em cada tubo, adicionou-se um determinado ser vivo:

– Tubo I: algas

– Tubo II: algas

– Tubo III: caramujos

– Tubo IV: algas e caramujos

Em seguida, diz-se que os tubos I e III foram iluminados com luz amarela, enquanto os tubos II e IV foram iluminados com luz azul. Por fim, pergunta-se qual tubo mudou a cor de vermelho para roxo mais rapidamente.

Para resolver esta questão, basta analisarmos a ocorrência de fotossíntese e respiração em cada tubo, assim como a taxa de fotossíntese em função do tipo de luz utilizado.

Primeiramente, devemos analisar, em quais tubos, a taxa de fotossíntese deverá ser maior e menor. Para isso, analisem o gráfico. Após isso, pergunto a vocês: “Quais tubos apresentam maior taxa de fotossíntese? I e III ou II e IV?”; a resposta é simples: de acordo com o gráfico, os tubos II e IV (iluminados com luz azul) apresentam maior taxa de fotossíntese, enquanto os tubos I e III apresentam taxa fotossintética mais baixa.

Sabendo disso, devemos nos perguntar: “No tubo em que a cor vermelha se transforma mais rapidamente em roxo, deverá haver aumento ou redução da concentração de CO2?”; repare que o próprio enunciado nos dá essa informação na primeira figura, indicando que a diminuição da concentração de CO2 é que faz a solução ficar roxa. Então, devemos nos perguntar: “Para que a concentração de CO2 diminua mais rapidamente e a solução fique roxa, deveremos aumentar ou diminuir o consumo de CO2 nos dois tubos?”; se o objetivo é reduzir a quantidade de CO2, o consumo terá que aumentar. Então, pergunto: “Qual processo consome CO2?”; a resposta é fotossíntese. Sendo assim, podemos deduzir que, quanto maior a taxa de fotossíntese, maior será o consumo de CO2 e mais rapidamente a solução mudará de vermelho para roxo.

Tendo isso em mente, vamos relembrar que deduzimos anteriormente que a taxa de fotossíntese era maior nos tubos II e IV. Agora, devemos nos perguntar: “Em qual desses tubos a mudança de vermelho para roxo ocorrerá mais rapidamente?”.  Repare que o tubo II só possui algas, ou seja, elas poderão consumir CO2 na fotossíntese e produzi-lo por meio da respiração celular. No tubo IV, temos algas e caramujos; as algas irão consumir CO2 na fotossíntese e produzi-lo na respiração, enquanto os caramujos irão apenas produzir CO2 na respiração celular. Sendo assim, em qual dos dois tubos, a concentração de CO2 se reduzirá mais rapidamente? Repare que no tubo IV, tanto as algas quanto os caramujos produzem CO2, ou seja, a redução da quantidade desse gás será mais lenta quando comparada ao tubo II, que só contém algas. Sendo assim, a diminuição da quantidade de CO2 e, consequentemente, a mudança mais rápida da cor vermelha para roxa ocorre no tubo II. Logo, a resposta correta é a alternativa B.

43) Esta questão exige conhecimento sobre o controle hormonal da glicemia. O enunciado apresenta três gráficos. O primeiro representa a concentração de glicose no sangue de dois indivíduos A e B. O segundo e o terceiro, por sua vez, representa a concentração de dois hormônios no sangue desses indivíduos.

A pergunta menciona que um dos indivíduos sofre de diabetes tipo II e pede-se para identificá-lo. Para resolver este problema, basta observar a característica mais marcante do diabetes, a hiperglicemia (taxa elevada de glicose no sangue). Ao analisarmos o primeiro gráfico, vemos que o indivíduo A possui taxa de glicose mais elevada. Portanto, este é o indivíduo diabético.

Além disso, pede-se pra identificar qual gráfico (X ou Y) representa o hormônio glucagon. Para resolver isso, basta lembrar que dois hormônios, produzidos pelo pâncreas, afetam a glicemia: a insulina e o glucagon. Em postagens anteriores já discutimos os efeitos desses dois hormônios, mas vale a pena relembrar:

– A insulina é um hormônio produzido e liberado no sangue quando o corpo encontra-se bem alimentado; seus principais efeitos envolvem a redução da glicemia e o estímulo do armazenamento de glicose sob a forma de glicogênio no fígado e no músculo, assim como o armazenamento de triglicerídeos no tecido adiposo.

– O glucagon é produzido e liberado no sangue em condições de jejum e estimula a síntese de glicose, assim como o consumo das reservas energéticas (glicogênio e triglicerídeos).

Tendo essas informações, devemos analisar os gráficos X e Y. Após a ingestão de glicose (tempo 0), o que deverá ocorrer com os níveis de insulina e glucagon? A resposta é simples: após a ingestão de glicose, temos um estado bem alimentado; logo, os níveis de insulina tendem a aumentar e os de glucagon tendem a diminuir. Sendo assim, o gráfico Y representa o glucagon. Desse modo, a resposta correta é a alternativa B.

44) Esta questão aborda o conceito de biomassa e compara este parâmetro em dois ecossistemas distintos: terrestres e marinhos.

Para resolvê-la, basta recordar o conceito de biomassa, que envolve a quantidade de matéria orgânica por área presente um dado nível trófico e comparar os dois ecossistemas:

– Terrestres: apresentam grande diversidade de produtores de maior porte, amplamente distribuídos. Logo, possuem maior biomassa quando comparado aos demais níveis tróficos;

– Marinhos: apresentam menor diversidade de produtores (basicamente as algas) com pequeno porte e são amplamente consumidas pelos consumidores primários, que apresentam maior biomassa.

Sabendo disso, a resposta correta é a alternativa C.

Olá vestibulandos,

O segundo exame de qualificação da UERJ se aproxima e hoje trazemos uma lista com 10 questões de fisiologia animal retiradas diretamente de exames anteriores da universidade. Este tópico tem costume de ser abordado. Então, é sempre bom estar atentos. Bora estudar!!! Rumo ao conceito A!!!

Abaixo, temos o link com a lista das questões:

FISIOLOGIA ANIMAL

Vamos aos comentários:

1) Esta questão apresenta uma resolução simples e direta, bastando apenas observar as informações que o enunciado nos apresenta:

– As lipases são enzimas que realizam a digestão de lipídios;

– O medicamento mencionado inibe essas enzimas (as lipases), possibilitando a perda de peso;

Tendo isso em mente, devemos nos perguntar: “Em qual órgão as lipases são produzidas?”. A resposta é simples: a lipase é uma enzima presente no suco pancreático e, portanto, é produzida no pâncreas. Logo, a resposta correta é a letra C.

A tabela abaixo resume bem o processo de digestão química e auxilia na resolução da maioria das questões sobre enzimas digestivas:

digestão

2) Esta questão aborda a temática sobre ciclo menstrual e regulação por feedback. Para resolvê-la, vamos focar sobre o processo regulatório da produção de hormônios. Observe o texto abaixo:

– O hipotálamo e a hipófise apresentam importante papel no controle da produção de hormônios pelas diversas glândulas endócrinas. O primeiro é responsável por controlar a produção de hormônios pela hipófise. Esta, por sua vez, controla a produção de hormônios da tireoide, das glândulas adrenais e das gônadas (ovários e testículos). Este processo de regulação é extremamente essencial para a manutenção dos níveis hormonais adequados às diversas condições a qual o organismo é exposto e também representa uma forma do corpo responder às diversas mudanças. Geralmente, alguns hormônios hipotalâmicos (TRH, GHRH, etc) estimulam a produção e liberação de hormônios pela hipófise e esta, por sua vez, estimula a produção de hormônios na tireoide, nas adrenais e nas gônadas. Neste caso, onde os níveis de um hormônio estimulam a produção de outro, fala-se em feedback positivo, pois aumenta-se a intensidade da resposta. No entanto, níveis elevados de um determinado hormônio, podem diminuir a produção de outro, falando-se em feedback negativo. Observe a tabela abaixo, que apresenta três exemplos desse tipo de regulação:

feedback

Nos três casos, os estímulos fornecidos pelos hormônios hipotalâmicos e hipofisários representam casos de feedback positivo, pois aumentarão os efeitos gerados pelos hormônios produzidos pelas demais glândulas endócrinas. Contudo, quando os níveis dos hormônios produzidos por tireoide, adrenais e gônadas tornam-se muito elevados, os mesmos tendem a inibir (diminuir) a produção de hormônios pela hipófise ou mesmo pelo hipotálamo; nesse caso, fala-se em feedback negativo. Ambos os mecanismos tendem a favorecer a restauração da homeostase (equilíbrio corporal).

Sabendo o que foi explicado acima, podemos resolver a nossa questão. Os hormônios FSH e LH, cujos níveis estão apresentados nos gráficos, controlam a produção de progesterona e estrogênio pelos ovários. Sendo assim, se uma mulher toma anticoncepcional (que contém progesterona e estrogênio), os níveis desses dois hormônios tenderão a aumentar no sangue. Uma vez que a quantidade de progesterona e estrogênio está maior, ocorrerá inibição da liberação de FSH e LH pela hipófise, de modo que os níveis dos dois se reduzam. Sendo assim, a resposta correta é a letra C.

3) Esta questão fala sobre a regulação hormonal da função renal. Para resolvê-la, basta utilizarmos as informações presentes em seu enunciado. Algumas dessas informações são extremamente relevantes, como:

– O hormônio aldosterona aumenta a absorção de Na+ pelos túbulos renais;

– Quanto a menor a concentração de Na+ nos líquidos extracelulares, maior será a produção de aldosterona.

Sabendo disso, vamos analisar a pergunta apresentada na questão. Diz-se que um paciente foi submetido a uma rígida dieta com restrição de NaCl e pede-se pra indicar qual curva do gráfico representa a alteração nesse paciente em função dessa dieta. Inicialmente, vamos analisar a dieta: “Se a dieta impõe restrição à ingestão de NaCl, o que ocorrerá com a concentração de Na+ no organismo?”; tenderá a diminuir, visto que o paciente está ingerindo pouco sódio em sua dieta. Agora, vamos raciocinar: “Se a concentração de Na+ está diminuindo, o que ocorrerá com a produção de aldosterona?”; o próprio enunciado já nos diz que a produção desse hormônio irá aumentar. Agora, pergunto a vocês: “Se a produção de aldosterona aumenta, o corpo absorverá mais ou menos Na+?”; é claro que irá absorver maior quantidade de sódio. Contudo, a questão apresenta um problema. O gráfico apresenta a taxa de absorção de água em vez da absorção de sódio. Ora, isso é simples: se estamos reabsorvendo mais sódio, a tendência é que o corpo reabsorva maior quantidade de água, visando manter o equilíbrio osmótico e hidrossalino. Sendo assim, a curva III representa o caso desse paciente e, portanto, a resposta correta é a alternativa B.

CURIOSIDADE: vimos nesta questão que, quanto maior a reabsorção de sódio, maior a reabsorção de água. Este mesmo princípio explica a razão pela qual o sal eleva a pressão arterial. Quando ingerimos grande quantidade de sódio, o corpo tende a reabsorver mais água, elevando o débito cardíaco (volume de sangue bombeado pelo coração em um minuto), o que provoca o aumento da pressão.

4) Esta questão fala sobre o uso de pastilhas de iodeto de potássio para tratar tumores em determinada glândula endócrina. Para resolvê-la, basta recordarmos qual das glândulas mencionadas nas alternativas necessita de iodo para produzir seus hormônios. A única glândula, cujo iodo está presente em seus hormônios é a TIREOIDE. A falta desse nutriente pode provocar hipotireoidismo, que é uma insuficiência na produção de hormônios tireoidianos, que afeta o metabolismo. Sendo assim, a resposta correta é a alternativa A.

5) A resolução desta questão requer conhecimento sobre os valores de pH ideais para a ação das enzimas digestivas. Para resolvê-la, podemos usar a tabela apresentada na resolução da questão 1. Se consultarmos esta tabela, veremos que o suco duodenal apresenta valor de pH variando na faixa entre 7 e 8. Logo, suas enzimas apresentam maior atividade nessa faixa de pH. Agora, devemos analisar cada uma das curvas apresentadas e verificar em quais valores aproximados de pH, as mesmas apresentam atividade máxima. Ao fazerem isso, vocês deverão verificar:

– Curva X: a atividade enzimática máxima está na faixa de pH entre 7 e 8.

– Curva Y: a atividade enzimática é máxima em pH igual a 10.

– Curva W: a atividade enzimática é máxima por volta de pH igual a 2.

– Curva Z: a atividade enzimática é máxima em valor de pH entre 11 e 12.

Analisando cada caso, devemos nos perguntar: “Qual dessas curvas apresenta uma atividade enzimática máxima condizente com as características do suco duodenal obtidas na tabela da resolução da questão 1?”. A resposta é simples: somente a curva X representa uma enzima que atue melhor em pH na faixa entre 7 e 8. Sendo assim, a resposta correta é a alternativa B.

6) Esta questão aborda a temática sobre regulação do pH sanguíneo. Para resolvê-la, devemos relembrar que a concentração de CO2 no sangue é capaz de influenciar o pH do mesmo. Isso se deve à ocorrência da reação química abaixo apresentada:

ácido

Nesta reação, o CO2 reage com a água, formando ácido carbônico (H2CO3). Este, por sua vez, pode se ionizar e formar íons H+ e HCO3 (bicarbonato). O bicarbonato e o ácido carbônico formam um sistema-tampão do sangue, ou seja, um mecanismo que buscar impedir grandes variações no pH sanguíneo. Isto significa que, quando houver excesso de ácido no sangue, a formação de bicarbonato na segunda reação aumentará, de modo a neutralizar essa acidez. Por outro lado, se houver excesso de bases no sangue, a formação de ácido carbônico na segunda reação será favorecida e o pH voltará ao normal.

Agora que já sabemos o conceito, vamos tentar resolver a questão. No enunciado fala-se em um equipamento responsável pela remoção do CO2 de uma cápsula espacial. Após isso, diz-se que, em determinado momento, o equipamento parou de funcionar e pergunta-se o que ocorrerá com o pH sanguíneo sob estas condições. Vamos raciocinar cada situação separadamente. Primeiro, devemos nos perguntar: “Se o equipamento parar de funcionar, o que ocorrerá com a concentração de CO2 no interior da cápsula?”; a resposta é que a concentração de CO2 aumentará, visto que não está ocorrendo mais a sua remoção daquele ambiente. Em seguida, devemos nos perguntar: “Com o acúmulo de CO2 dentro da cápsula, o que ocorrerá com a concentração desse gás no sangue da tripulação?”; novamente a concentração aumentará, visto que estarão inalando maior quantidade deste gás. Por fim, devemos nos perguntar: “Se a concentração de CO2 está alta no sangue, formaremos maior ou menor quantidade de ácido carbônico?”; é claro que formaremos mais ácido carbônico.

Sabendo disso, basta deduzirmos a resposta. Concluímos que a falha no equipamento leva a uma maior produção de ácido carbônico. Se estamos aumentando a quantidade de ácido no sangue, o pH diminuirá. Logo, a resposta correta é a alternativa D.

FIQUE ATENTO!!!!

equilíbrio ácido básico

7) Esta questão aborda a temática sobre a digestão de proteínas e a quantidade do produto desse processo (os aminoácidos) em diversos compartimentos do tubo digestivo. Para resolvê-la, basta recordarmos que a digestão de proteínas ocorre em três compartimentos específicos: estômago, duodeno e jejuno-íleo. Outra informação relevante para sua resolução é que a digestão proteica se inicia no estômago, prossegue no duodeno e completa-se no jejuno-íleo.

Sabendo disso, a resolução da questão torna-se bastante simples. Uma vez que a digestão de proteínas se inicia no estômago, a quantidade de aminoácidos (produtos finais da digestão proteica) nesse órgão tende a ser menor que nos outros dois citados no enunciado. Sendo assim, o estômago é representado pela curva Y. No duodeno, a digestão de proteínas irá prosseguir e a quantidade de aminoácidos tende a aumentar; contudo, como a digestão proteica ainda está ocorrendo no duodeno, sua quantidade não será ainda a quantidade total (final) de aminoácidos obtidos na digestão de proteínas. Logo, o duodeno é representado pela curva Z. No jejuno-íleo, após todo o processo de digestão proteica ter ocorrido, estará presente toda a quantidade final de aminoácidos. Logo, este órgão é representado pela curva X. Sendo assim, a resposta correta é a letra D.

8) A resolução desta questão é bastante simples. Exige apenas o conhecimento sobre as características das principais excretas animais:

– Amônia: composto bastante solúvel em água e principal excreta de peixes ósseos e invertebrados aquáticos;

– Ureia: composto solúvel em água e principal excreta de mamíferos, peixes cartilaginosos e anfíbios adultos;

– Ácido úrico: composto pouco solúvel em água e principal excreta de répteis e aves.

Tendo em vista as informações acima apresentadas, podemos deduzir que o ser humano (que é um mamífero) é representado pelo gráfico 1, onde maior quantidade de ureia é eliminada, enquanto os répteis são representados pelo gráfico 3, visto que maior quantidade de ácido úrico é eliminado neste caso. Sendo assim, a resposta correta é a alternativa A.

9) Para resolver esta questão podemos utilizar algumas informações discutidas em um tópico anterior sobre questões de bioquímica na prova da UERJ. Em tal tópico, citei as seguintes informações:

– Sob estado bem alimentado, pouco tempo após a refeição, os níveis de um hormônio pancreático chamado de INSULINA se elevam no sangue. Este hormônio irá ativar algumas vias metabólicas, como, por exemplo, a glicólise (quebra da glicose em piruvato) e a glicogênese (síntese de glicogênio), assim como a síntese de ácidos graxos a partir de acetil-CoA e o armazenamento de triglicerídeos no tecido adiposo. Sob estado de jejum, um outro hormônio pancreático, chamado GLUCAGON, passa a controlar as diversas vias metabólicas, ativando as vias de degradação (catabolismo), como, por exemplo, a glicogenólise (quebra de glicogênio em glicose), o consumo dos triglicerídeos presentes no tecido adiposo e a oxidação dos ácidos graxos, a desaminação dos aminoácidos (que gera piruvato e intermediários presentes no ciclo de Krebs) e ativa uma via de síntese chamada de gliconeogênese (síntese de glicose, a partir de intermediários como piruvato, glicerol ou aminoácidos). Em resumo, a insulina estimula o organismo a “guardar” a glicose no fígado sob a forma de glicogênio e os ácidos graxos no tecido adiposo sob a forma de triglicerídeos. O glucagon, por sua vez, estimula o consumo das reservas energéticas (glicogênio hepático e muscular e os triglicerídeos), assim como a síntese de glicose no corpo.

 Analisando o esquema apresentado na questão e observando as informações apresentadas acima conseguiremos resolvê-la sem maiores dificuldades. Então, analisemos o que é observado no esquema:

 – Fígado: se observarem com atenção, no fígado está ocorrendo quebra do glicogênio em glicose e síntese de glicose a partir de aminoácidos. Essas características são condizentes com o estado de jejum, como mencionado no texto acima.

– Sangue: repare que a glicose está saindo do fígado e indo para o sangue, ficando acumulada no mesmo.

– Tecido adiposo: está ocorrendo quebra de triglicerídeos em ácidos graxos e glicerol. Essa condição também é comum quando temos um estado de jejum.

– Músculo: está recebendo ácidos graxos provenientes do tecido adiposo e oxidando-os até CO2 e H2O para produzir energia.

 Agora que observamos isso, analisemos cada uma das alternativas apresentadas:

– Repouso: essa condição corresponde à situação em que o suprimento de energia está alto no corpo, ou seja, o organismo está bem alimentado. Neste caso, os níveis de insulina deveriam estar elevados e os processos de síntese de glicose e quebra de glicogênio e triglicerídeos, assim como a oxidação de ácidos graxos não deveriam estar ocorrendo. Logo, o esquema não representa tal situação.

– Hiperinsulinismo: condição em que os níveis de insulina estão elevados no sangue. Nesse caso, não deveriam ocorrer a síntese de glicose, a quebra de triglicerídeos e glicogênio, assim como a oxidação de ácidos graxos. Logo, o esquema não representa tal situação.

– Dieta hiperglicídica: condição em que uma pessoa consome grande quantidade de glicídios (carboidratos) em sua alimentação. Nesta circunstância, o corpo não necessita consumir o glicogênio armazenado no fígado e nem sintetizar mais glicose. Logo, o esquema não representa esta situação.

– Diabetes melito: doença em que ocorre hiperglicemia (excesso de glicose no sangue), como observado no esquema. Em função da falta de insulina, a glicose não é levada para o interior das células, de modo que o corpo passa a consumir suas reservas energéticas, como, por exemplo, os triglicerídeos e o glicogênio, assim como sintetizar glicose e oxidar ácidos graxos. Todos esses efeitos são observados no esquema.

Sendo assim, a resposta correta é a letra B.

10) Esta questão fala sobre as junções neuromusculares. Para resolvê-la, devemos lembrar de algumas informações:

– A contração muscular depende de estímulos fornecidos por uma terminação nervosa. Esse estímulo é gerado por substâncias, chamadas de neurotransmissores, que são liberadas pelos neurônios e que atuam sobre receptores presentes no músculo. Uma dessas substâncias com papel de induzir a contração muscular é a acetilcolina.

– O processo de contração muscular envolve alguns eventos. Inicialmente, mediante o estímulo do neurotransmissor (por exemplo, acetilcolina), o cálcio presente no retículo sarcoplasmático é liberado, ocupando o citosol (citoplasma) da fibra muscular. Esse processo desencadeia a contração muscular.

Tendo em vista as informações acima, podemos resolver a questão sem maiores dificuldades. Repare que no enunciado diz-se que o aldicarb (chumbinho) inibe uma enzima chamada acetilcolinesterase, que é responsável pela degradação da acetilcolina e pergunta-se qual gráfico representará a concentração de cálcio no retículo sarcoplasmático e no citosol do músculo de uma pessoa que tenha ingerido essa substância.

Vamos raciocinar com calma. O aldicarb inibe a acetilcolinesterase; qual será o efeito desta inibição? A resposta é simples: se a acetilcolinesterase degrada a acetilcolina e está inibida, não haverá degradação de acetilcolina e a mesma se acumulará na junção neuromuscular. Agora, vamos nos perguntar: “Se temos acúmulo de acetilcolina, o que ocorrerá com o cálcio?”; vimos acima que, mediante o estímulo da acetilcolina, o cálcio sai do retículo e vai para o citosol. Sabendo disso, o que ocorrerá com a quantidade de cálcio no retículo e no citosol? A resposta é simples: a quantidade de cálcio diminuirá no retículo e aumentará no citosol. Sendo assim, vemos que apenas o gráfico II representa tal situação. Logo, a resposta correta é a alternativa B.

Hoje trazemos os comentários de 12 questões de bioquímica abordadas nos diversos exames de qualificação da UERJ. O link abaixo apresenta as questões:

aulão1

Agora, vamos aos comentários:

1) Para resolver esta questão precisamos relembrar o conceito geral de síntese de proteínas:

“Processo dividido em duas etapas. A primeira é chamada de transcrição e envolve a formação de uma molécula de RNA a partir de uma sequência de DNA. Em seguida, ocorre à tradução, processo em que a molécula de RNA é lida e formará uma molécula de proteína.”

Agora, devemos analisar as informações apresentadas no gráfico. Repare que, neste caso, o gráfico indica a quantidade de proteínas formadas em ovos fertilizados e não-fertilizados de ouriço do mar mediante a marcação com um elemento radioativo (14C). Então, pergunto a vocês: quais diferenças são observadas ao comparar ovos não-fertilizados com fertilizados? Se vocês observarem atentamente o gráfico, irão ver que a quantidade de proteínas é muito maior em ovos fertilizados do que nos não-fertilizados. Então, realizou-se uma experiência. Nela, adicionou-se um antibiótico (actinomicina D) ao meio que continham ovos fertilizados e determinou-se a quantidade de proteínas formadas. O enunciado informa também que este antibiótico inibe a transcrição, ou seja, impede a formação de RNAm a partir de DNA. Então, pergunto a vocês: a presença do antibiótico afetou a formação de proteínas nos ovos fertilizados? Se analisarem atentamente o gráfico, irão verificar que a quantidade de proteínas permaneceu praticamente igual aos ovos fertilizados que não receberam antibiótico.
Agora, vamos analisar as alternativas:

a) Observamos que a quantidade de proteínas aumentou significativamente após a fertilização dos ovos. Contudo, isso não indica que a estabilidade das mesmas tenha aumentado. ALTERNATIVA INCORRETA!

b) A tradução é a formação de proteínas a partir do RNA. No item, diz-se que a tradução seria a formação de RNA a partir de DNA, ou seja, o item apresenta uma afirmativa errada, ALTERNATIVA INCORRETA!

c) A transcrição é a formação de RNA a partir de uma sequência de DNA e não a conversão do RNA em proteínas. ALTERNATIVA INCORRETA!

d) Repare que o enunciado diz que o antibiótico inibe a transcrição, ou seja, diminui a formação de RNAm. Como o RNAm será traduzido em proteína posteriormente, quanto maior a taxa de transcrição maior a quantidade de proteínas. Logo, se o antibiótico houvesse bloqueado a transcrição, esperávamos que a quantidade de proteínas nos ovos fertilizados tratados com antibiótico fosse diminuir, o que não ocorreu. Sendo assim, isso indica que a transcrição já havia ocorrido antes da adição do antibiótico. ALTERNATIVA CORRETA!

 

2) Essa questão trata de um método aplicado em laboratórios de pesquisa conhecido como ELETROFORESE EM GEL. Caso tenham interesse em compreender o método, o vídeo abaixo apresenta uma ilustração bastante didática e, embora esteja em inglês, apresenta legenda:

http://www.youtube.com/watch?v=TZ-K13Y4ffw

Mas para resolvê-la não é necessário conhecermos o procedimento. Basta compreendermos três pontos essenciais:

– As proteínas podem apresentar carga positiva, negativa ou nula em função do pH do meio onde se encontram. Geralmente, em pH ácido apresentam carga negativa e em pH básico apresentam carga positiva.

– O ponto isoelétrico (pI) de uma proteína representa o pH em que a mesma apresenta carga nula.

– Quanto maior a diferença entre o pI da proteína e o pH do meio, maior será sua carga.

Os três tópicos acima são apresentados no enunciado e bastam para que possamos resolver esta questão. A primeira informação que vamos aplicar é o fato da diferença o pI e o pH indicarem qual proteína possui maior ou menor carga. No enunciado, apresentam-se quatro proteínas e diz-se que o pH do meio é igual a 6,0. A primeira proteína tem pI igual a 8,0; logo, a diferença para o pH do meio é igual a 2. A segunda proteína tem pI igual a 7,6; logo, a diferença para o pH é igual a 1,6. A terceira proteína tem pI igual a 6,6; logo, a diferença para o pH é igual a 0,6. Por fim, a quarta proteína possui pI igual a 4,8 e diferença de 1,2 para o pH do meio. Sabendo essas diferenças, podemos ordenar as proteínas em função de suas cargas.
LEMBRE-SE!!! Quanto maior a diferença, maior a carga da proteína. Então, como ficaria a ordem crescente de proteínas em função de suas cargas? O correto seria:

Alfaglobulina < Albumina < Betaglobulina < Gamaglobulina

No entanto, na pergunta, questiona-se qual a ordem crescente de velocidade de migração. Basta lembrarmos o seguinte:

“Quanto maior a carga, maior a velocidade de migração da proteína!”

Sendo assim, a proteína que apresentar menor carga, terá menor velocidade de migração e vice-versa. Desse modo, a ordem crescente das velocidades é igual a ordem crescente das cargas das proteínas. Logo, a resposta correta seria a letra D.

 

3) Este enunciado aborda a temática do controle de pH sanguíneo e dos sistemas-tampão do sangue.
O sangue apresenta como principal mecanismo de controle do pH, um sistema-tampão chamado de bicarbonato/ácido carbônico (HCO3-/H2CO3). Neste caso, o CO2 presente no sangue reage com a água, formando ácido carbônico, que se ioniza e forma íons H+ e HCO3- (bicarbonato), como representado na reação apresentada no enunciado. Sendo assim, a concentração de CO2 no sangue irá influenciar indiretamente no valor do pH. Raciocinemos da seguinte forma:

“Se aumentarmos a concentração de CO2 no sangue, o que ocorrerá com a quantidade de H+ formado? Também aumentará. Sendo assim, um aumento no CO2 no sangue, aumenta a concentração de H+.”

Agora, analisemos a situação apresentada. No enunciado da questão, fala-se que o pH sanguíneo é controlado pelo ritmo respiratório e menciona-se uma condição chamada de HIPERVENTILAÇÃO, perguntando o que ocorrerá com a concentração de H+ e com o pH quando estamos nessa condição. Para auxiliar-nos, o enunciado apresenta uma tabela, em que quatro combinações distintas de concentração de H+ e de pH são apresentadas como alternativas. Se vocês tiverem atenção, observarão que duas das condições apresentadas não podem ser corretas: I e IV. Lembre-se que a concentração de H+ é inversa ao pH; quanto maior a concentração de H+, menor será o pH e vice-versa. Sendo assim, a concentração de H+ e o pH não podem estar altos ao mesmo tempo, nem baixos ao mesmo tempo.
Agora, vamos avaliar a situação apresentada na questão. Sob hiperventilação, o que irá ocorrer com a concentração de CO2 no sangue? No próprio enunciado, diz-se que aumenta a eliminação de CO2 pela expiração. Sendo assim, a concentração de CO2 irá diminuir no sangue, provocando uma redução na concentração de H+. Logo, a concentração de H+ fica baixa e o pH fica mais alto. Desse modo, a resposta correta é a letra C.

 

4) Esta questão aborda a temática do metabolismo energético muscular. Para auxiliar na resolução, duas informações são apresentadas no enunciado: uma tabela e um esquema do metabolismo energético. A tabela indica três tipos de corridas (100, 400 e 800 m) e o percentual de energia obtida por fonte aeróbia e anaeróbia em cada uma dessas corridas.
Para resolvê-la, basta recordarmos sobre as fontes aeróbias e anaeróbias de produção de energia. O metabolismo de carboidratos se inicia com a glicólise (quebra de glicose, formando duas moléculas de piruvato). Uma vez que ocorreu a glicólise, o piruvato pode seguir caminhos distintos:

– Na presença de O2: o piruvato é convertido em acetil-CoA e participa do ciclo de Krebs e da fosforilação oxidativa. Este processo caracteriza a RESPIRAÇÃO CELULAR.

– Na ausência de O2: o piruvato é convertido em lactato, caracterizando a FERMENTAÇÃO LÁCTICA.

Agora, vamos avaliar a pergunta apresentada: “Ao final da corrida de 400 m, a maior parte da energia despendida é oriunda da atividade metabólica ocorrida em quais etapas?”. Ao analisarmos a tabela, vemos que 70% da energia obtida pelo recordista na corrida de 400 m é de fonte anaeróbia. Sabendo disso, podemos deduzir que a energia provém da fermentação láctica. Baseado no conceito apresentado acima, sabemos que a fermentação envolve a conversão de piruvato a lactato. Desse modo, a alternativa correta é a letra A.

 

5) A questão abaixo apresenta um esquema de diversas etapas do metabolismo de carboidratos nos seres vivos. Se analisarmos o esquema atentamente, veremos que ocorre a síntese e degradação de uma série de carboidratos (celulose, glicogênio, amido e glicose). Então, pergunta-se quais dessas etapas ocorrem nos consumidores primários. Para resolvê-la, devemos analisar os diversos pares de etapas.
Inicialmente, vamos analisar as etapas 1 e 2. A etapa 1 representa a conversão de CO2 e H2O em glicose (C6H12O6), enquanto a etapa 2 representa a conversão de glicose, formando CO2 e água. Então, devemos nos perguntar: “Qual processo absorve gás carbônico e água e forma glicose? E qual processo envolve a quebra de glicose, formando gás carbônico e água?”.
A resposta é extremamente simples: o processo 1 representa a fotossíntese e o processo 2 é a respiração celular. Lembrem-se das equações gerais desses dois processos:

Fotossíntese: 6 CO2 + 12 H2O → C6H12O6 + 6 O2 + 6 H2O

Respiração Celular: C6H12O6 + 6 O2 → 6 CO2 + 6 H2O

Agora, devemos nos perguntar qual(is) desse(s) processo(s) são realizados pelos consumidores primários. Se é um consumidor, significa que ele se alimenta de outros seres vivos, ou seja, é um organismo heterótrofo. Sendo assim, podemos deduzir que eles não realizam a fotossíntese. Desse modo, as alternativas A e B estão incorretas. Contudo, todos os seres vivos, sem exceção, realizam a respiração celular (inclusive os consumidores). Sendo assim, a alternativa B é a resposta correta. Repare! Sabendo esta única informação, você consegue resolver a questão.

cadeias

 

 

6) O esquema abaixo pode auxiliar na resolução da questão, visto que apresenta uma representação geral de diversas etapas metabólicas que ocorrem no fígado, como, por exemplo, síntese e degradação de glicogênio e de glicose, oxidação de ácidos graxos e desaminação dos aminoácidos. Os processos de síntese caracterizam o ANABOLISMO, enquanto as reações de degradação envolvem o CATABOLISMO.

metabolismo fígado

Agora, devemos considerar que a ocorrência das etapas representadas no esquema acima irá variar em função da condição metabólica. Em termos gerais, o organismo possui dois estados metabólicos: jejum e bem alimentado.

Sob estado bem alimentado, pouco tempo após a refeição, os níveis de um hormônio pancreático chamado de INSULINA se elevam no sangue. Este hormônio irá ativar algumas vias metabólicas, como, por exemplo, a glicólise (quebra da glicose em piruvato) e a glicogênese (síntese de glicogênio), assim como a síntese de ácidos graxos a partir de acetil-CoA e o armazenamento de triglicerídeos no tecido adiposo.

Sob estado de jejum, um outro hormônio pancreático, chamado GLUCAGON, passa a controlar as diversas vias metabólicas, ativando as vias de degradação (catabolismo), como, por exemplo, a glicogenólise (quebra de glicogênio em glicose), o consumo dos triglicerídeos presentes no tecido adiposo e a oxidação dos ácidos graxos, a desaminação dos aminoácidos (que gera piruvato e intermediários presentes no ciclo de Krebs) e ativa uma via de síntese chamada de gliconeogênese (síntese de glicose, a partir de intermediários como piruvato, glicerol ou aminoácidos).  

Em resumo, a insulina estimula o organismo a “guardar” a glicose no fígado sob a forma de glicogênio e os ácidos graxos no tecido adiposo sob a forma de triglicerídeos. O glucagon, por sua vez, estimula o consumo das reservas energéticas (glicogênio hepático e muscular e os triglicerídeos), assim como a síntese de glicose no corpo.

Considerando estas informações, podemos responder à pergunta apresentada na questão. Repare que é perguntado quais etapas são ativadas após uma pessoa se manter por jejum por 24h. Já sabemos que o jejum estimula a glicogenólise, a oxidação dos ácidos graxos, a desaminação dos aminoácidos e a gliconeogênese. Sabendo disso, podemos deduzir que esses quatro processos metabólicos, representados pelos itens 1, 3, 5 e 6, estarão ocorrendo mais intensamente. Sendo assim, o gráfico X representa esta condição e a resposta correta é a letra B.

 

7) Esta questão aborda os conceitos gerais de respiração celular e fermentação láctica. Para resolvê-la, precisamos recordar brevemente estes dois processos:

 – A respiração celular aeróbia é um processo dividido em três etapas glicólise (quebra de glicose em piruvato), ciclo de Krebs e cadeia respiratória (ou transportadora de elétrons). A primeira etapa é anaeróbia, ou seja, ocorre na ausência de O2. Contudo, a ocorrência do ciclo de Krebs e da cadeia respiratória (etapas mitocondriais) irá depender da disponibilidade de oxigênio, visto que o mesmo atua como aceptor final de elétrons na cadeia respiratória.

 – A fermentação láctica é uma via alternativa de reoxidação do NADH (o NAD é necessário para a continuidade da glicólise), que ocorre em condições anaeróbias, convertendo o piruvato em lactato.

 No enunciado da questão, diz-se que foi adicionado um inibidor da cadeia respiratória e pergunta-se qual o ácido deverá acumular-se nesta condição. Vamos raciocinar juntos! Na presença de um inibidor de cadeia respiratória, esta etapa estará bloqueada. Como uma de suas funções envolve a reoxidação do NADH (transformá-lo novamente em NAD, para que possa ser reutilizado), alguém deverá substituir a cadeia respiratória neste processo. Sendo assim, na presença deste inibidor, o NADH será reoxidado pelo processo de fermentação láctica, promovendo o acúmulo de ácido láctico ou lactato. Desse modo, a resposta correta é a alternativa A.

nad

 

 

8) Esta questão aborda um tema relacionado com a química, que é o conceito de meia-vida, relacionado com a temática de radioatividade. Para resolvê-la, temos que relembrar o conceito de meia-vida:

 “Tempo necessário para que a quantidade de determinado material radioativo se reduza à metade.”

 Sabendo disso, podemos interpretar e resolver a questão. Ao analisar a tabela, podemos verificar que a radioatividade aumenta ao longo do tempo para as quatro proteínas estudadas (W, X, Y e Z). Contudo, a partir de 8 minutos, a radioatividade começa a diminuir. Para estimarmos a meia-vida dessas quatro proteínas marcadas deveremos observar a queda de radioatividade para cada uma das proteínas:

 – Proteína W: a radioatividade cai de 28 para 27 e depois para 26, ou seja, a cada dois minutos, a radioatividade cai uma unidade.

– Proteína X: a radioatividade cai de 25 para 23 e depois para 21, ou seja, a cada dois minutos, a radioatividade cai duas unidades.

– Proteína Y: a radioatividade cai de 24 para 21 e depois para 18, ou seja, a cada dois minutos, a radioatividade cai três unidades.

– Proteína Z: a radioatividade cai de 20 para 16 e depois para 11, ou seja, a cada dois minutos, a radioatividade cai em média 4,5 unidades.

 Agora, pergunto a vocês: “Considerando as informações acima, a meia-vida será menor para qual proteína?”. Basta relembrarmos o conceito de meia-vida e podemos deduzir que aquela proteína que decai mais rapidamente será aquela que possui menor meia-vida (menor tempo de decaimento). Sendo assim, a proteína de menor meia-vida é a Z. Logo, a resposta correta é a alternativa D.

 

9) Já vimos na questão 6 apresentada acima que, sob condição de jejum, o fígado realiza gliconeogênese, que é a síntese de glicose a partir de outras moléculas, como, por exemplo, piruvato, glicerol e aminoácidos. Dentre as moléculas mencionadas, somente uma está apresentada nas alternativas, que são os aminoácidos. Sendo assim, a resposta correta é a letra C.

 

10) Esta questão aborda os processos de fermentação. O enunciado apresenta um esquema do processo de fermentação láctica, indicando a conversão de piruvato a lactato. Então, pergunta-se qual o produto da fermentação realizada pela levedura utilizada na fabricação de cerveja. A levedura é um fungo que realiza fermentação alcoólica, processo em que o piruvato é convertido a etanol e gás carbônico.

Sabendo disso, podemos deduzir que a resposta correta é a alternativa A.

 

11) Esta questão aborda o tema proteínas. No enunciado, apresenta-se um gráfico, que indica a carga de quatro proteínas em função do pH do meio. Para resolver este item, precisamos ter atenção a uma informação apresentada:

 A molécula do DNA, em pH fisiológico, apresenta carga elétrica negativa, devido a sua natureza ácida. No núcleo celular, ela está associada a proteínas, de caráter básico, denominadas histonas.”

 Esta única informação ajuda-nos a solucionar a questão. Repare que diz-se que o DNA apresenta carga negativa em pH fisiológico. Qual é o pH fisiológico? É o pH mais comum dos fluidos corporais e seu valor é aproximadamente 7,4.

Agora, devemos avaliar outro ponto: diz-se que o DNA está associado a proteínas, de caráter básico, chamadas de HISTONAS. Então, pergunta-se qual das curvas do gráfico pode representar uma histona. Para resolver isso, basta lembrar-nos da lei de atração e repulsão, que diz que cargas opostas se atraem e cargas iguais se repelem. Então, pergunto a vocês: “Sabendo que o DNA possui carga negativa em pH fisiológico e tendo conhecimento da lei de atração e repulsão, qual deverá ser a carga das histonas, em pH fisiológico, para que possam interagir com o DNA?”. A resposta é simples: se o DNA possui carga negativa, só poderá interagir com proteínas que, em pH fisiológico, possuam carga positiva.

Então, analisemos o gráfico: somente a proteína W apresenta carga positiva em pH 7,4.  Sendo assim, a resposta correta é a alternativa A.

 

12) O enunciado da questão fala sobre os efeitos de uma droga, a aloxana, que destrói as células β das ilhotas pancreáticas. Além disso, apresenta quatro gráficos que representam a variação de três parâmetros distintos: taxa de glicose no sangue e na urina e taxa de glicogênio hepático. Por fim, pergunta-se qual gráfico representa os animais que foram previamente tratados com aloxana.

Para resolver esta questão, devemos nos perguntar qual a função das células β do pâncreas. A resposta é simples: estas células são responsáveis pela produção de insulina, um hormônio que controla o metabolismo. O principal efeito da insulina é o controle da glicemia (taxa de glicose no sangue). Esse hormônio remove a glicose do sangue e guarda-a nas células hepáticas e musculares sob a forma de glicogênio, de modo que reduz a glicemia.

Sabendo dos efeitos acima mencionados, podemos resolver a questão. Raciocinemos! A aloxana destrói as células β do pâncreas, de modo a provocar uma intensa redução na produção de insulina. Se os níveis de insulina diminuem no sangue, menor quantidade de glicose será removida, promovendo um aumento na glicemia (taxa de glicose no sangue). Sabendo disso, somente os gráficos W e Y podem estar corretos. Se pouca glicose está sendo retirada do sangue, isso implica que menor quantidade de glicogênio será formada no fígado; logo, a taxa de glicogênio hepático tenderá a diminuir. Sabendo disso, já podemos deduzir que o gráfico Y representa o animal tratado com aloxana. Então, deduzimos que a taxa de glicose na urina aumenta; isso se deve ao excesso de glicose no sangue é característico de pacientes diabéticos.

Desse modo, a resposta correta é a alternativa C.

EBOLA: UMA AMEAÇA MUNDIAL?

Publicado: 6 de agosto de 2014 em Sem categoria

Todos temos visto as notícias sobre a ocorrência da maior epidemia de Ebola na história. Mais de 1500 casos e quase 900 mortes até o presente momento. A epidemia por enquanto restringe-se a quatro países africanos: Guiné, Libéria, Serra Leoa e Nigéria. Contudo, um casal de médicos americanos está sendo tratado nos Estados Unidos. 

Um tema tão atual pode ser abordado em provas de vestibular. Por conta disso, disponibilizamos o texto abaixo, que representa uma tradução das informações sobre o vírus e a doença, que estão disponíveis no site da Organização Mundial de Saúde (OMS). Façam bom proveito

 

VÍRUS EBOLA

ebolavírus é um filovírus (o outro membro desta família é o vírus Marburg), com forma filamentosa, com 14 micrômetros de comprimento e 80 nanômetros de diâmetro. O seu genoma é de RNA fita simples de sentido negativo (é complementar à fita codificante). O genoma é protegido por capsídeo, é envelopado e codifica sete proteínas.

 

  • Doença do vírus Ebola (EVD), anteriormente conhecida como febre hemorrágica Ebola, é uma doença grave, fatal em seres humanos.
  • Surtos de EVD têm uma taxa de letalidade de até 90%.
  • Surtos de EVD ocorrem principalmente em aldeias remotas na África Central e Ocidental, perto de florestas tropicais.
  • O vírus é transmitido para as pessoas a partir de animais selvagens e se espalha na população humana através da transmissão de humano para humano.
  • Morcegos de fruta da família Pteropodidae são considerados o hospedeiro nativo do vírus Ebola.
  • Pacientes gravemente doentes requerem tratamento de suporte intensivo. Nenhum tratamento ou vacina específica licenciado está disponível para uso em pessoas ou animais.
  • Ebola apareceu pela primeira vez em 1976, em dois focos simultâneos, em Nzara, Sudão e em Yambuku, República Democrática do Congo. O último foi situado em uma vila perto do rio Ebola. O gênero Ebolavírus é 1 de 3 membros da família Filoviridae (filovírus), juntamente com marburgvirus e cuevavirus. É composto por cinco espécies distintas.

 

TRANSMISSÃO

Ebola é introduzido na população humana através de um estreito contato com o sangue, secreções, órgãos ou outros fluidos corporais de animais infectados. Na África, a infecção tem-se documentado através da manipulação de chimpanzés infectados, gorilas, morcegos frutívoros, macacos, antílopes florestais e porcos-espinhos encontrados mortos ou doentes ou na floresta.

Ebola se espalha na comunidade, em seguida, através da transmissão de humano para humano, resultando em infecção por contato direto (através da pele ou mucosas) com o sangue, secreções, órgãos ou outros fluidos corporais de pessoas infectadas, e contato indireto com ambientes contaminados com tais fluidos. Cerimônias fúnebres em que os enlutados têm contato direto com o corpo da pessoa falecida podem desempenhar um papel também na transmissão de Ebola. Homens que se recuperaram da doença ainda pode transmitir o vírus por meio de seu esperma para até sete semanas após a recuperação da doença.

Os profissionais de saúde foram frequentemente infectados durante o tratamento de pacientes com suspeita ou confirmação de EVD. Isto ocorreu através do contato próximo com pacientes. Precauções ao controle da infecção não são estritamente praticadas.

 

SINTOMAS

EVD é uma doença viral aguda grave frequentemente caracterizada pelo aparecimento súbito de febre, fraqueza intensa, dores musculares, dor de cabeça e dor de garganta. Isto é seguido por vômitos, diarreia, erupções cutâneas, e funções hepáticas e renais deficientes e, em alguns casos, hemorragia tanto interna como externa. Os achados laboratoriais incluem redução de glóbulos brancos e de plaquetas e aumento das enzimas hepáticas.

O período de incubação, isto é, o intervalo de tempo desde a infecção de vírus com o aparecimento dos sintomas, é de 2 a 21 dias.

 

VACINA E TRATAMENTO

Nenhuma vacina licenciada está disponível para EVD. Várias vacinas estão sendo testadas, mas nenhum deles está disponível para uso clínico.

Pacientes gravemente doentes requerem tratamento de suporte intensivo. Os pacientes estão desidratados e exigem frequentemente soluções de re-hidratação oral ou fluidos intravenosos contendo eletrólitos.

Nenhum tratamento específico está disponível. Novas terapias medicamentosas estão sendo avaliados.

 

PREVENÇÃO E CONTROLE 

1. Controle do Reston Ebolavírus em animais domésticos

  • Nenhuma vacina contra RESTV animal está disponível. A limpeza de rotina e desinfecção das fazendas (com hipoclorito de sódio ou outros detergentes) deve ser eficaz na inativação do vírus.
  • Em caso de um surto, o local deve ser colocado em quarentena imediatamente. O abate de animais infectados, com supervisão de enterro ou a incineração de carcaças, pode ser necessário para reduzir o risco de transmissão de animais para humanos. Restringir ou proibir a circulação de animais de fazendas infectadas para outras áreas pode reduzir a propagação da doença.
  • Como surtos RESTV em suínos e macacos têm precedido infecções humanas, o estabelecimento de um sistema de vigilância ativa em saúde animal para detecção de novos casos é essencial no fornecimento de alerta precoce para as autoridades de saúde pública veterinária e humana.

 

2. Redução do risco de infecção por Ebola nas pessoas

Na ausência de tratamento eficaz e uma vacina humana, a conscientização sobre os fatores de risco para a infecção pelo Ebola e as medidas de proteção podem tornar-se a única forma de reduzir a infecção humana e a morte.

Na África, durante surtos de EVD, mensagens de saúde pública de ensino para a redução de risco devem se concentrar em vários fatores:

  • Reduzir o risco de transmissão da vida selvagem para humano do contato com morcegos frutívoros infectados ou macacos e do consumo de sua carne crua. Os animais devem ser manuseados com luvas e outro vestuário de proteção adequado. Produtos de origem animal (carne e sangue) devem ser bem cozidos antes do consumo.
  • Reduzir o risco de transmissão de humano para humano oriundos do contato direto ou próximo com pacientes infectados, em particular com os seus fluidos corporais. Luvas e equipamento de proteção individual adequado devem ser usados quando cuidar de doentes em casa. Lavar as mãos regularmente é necessário depois de visitar os pacientes no hospital, bem como depois de cuidar dos pacientes em casa.
  • Comunidades atingidas por Ebola devem informar a população sobre a natureza das medidas de contenção do surto ou doença, incluindo o enterro dos mortos. Pessoas que morreram de Ebola devem ser prontamente enterradas, obedecendo às regras de segurança e proteção.

 

Granjas de suínos na África podem ter um papel na amplificação da infecção por causa da presença de morcegos frutívoros nestas fazendas. Medidas de biossegurança adequadas devem estar no local para limitar a transmissão. Para RESTV, mensagens educativas de saúde pública deve se concentrar na redução do risco de transmissão de suínos para humanos, resultante das práticas de abate e consumo inseguro de sangue fresco, leite cru ou tecidos animais. Luvas e outro vestuário de proteção adequado devem ser usados ao manusear os animais doentes ou seus tecidos. Em regiões onde haja relatos de RESTV em suínos, todos os produtos de origem animal (sangue, carne e leite) devem ser bem cozidos antes de comer.

 

3. Controlar a infecção em estabelecimentos de assistência à saúde

A transmissão do vírus Ebola entre pessoas é principalmente associada com o contato direto ou indireto com sangue e fluidos corporais.

Nem sempre é possível identificar os pacientes com EBV cedo porque os sintomas iniciais podem ser não específicos. Por esta razão, é importante que os profissionais de saúde apliquem consistentemente as precauções-padrão com todos os pacientes – independentemente do seu diagnóstico – em todas as práticas de trabalho em todos os momentos. Estes incluem a higiene básica, higiene respiratória, o uso de equipamento de proteção individual (de acordo com o risco de projeções ou de outro contato com materiais infectados), as práticas de injeção segura e práticas funerárias seguras.

Os profissionais de saúde que cuidam de pacientes com suspeita ou confirmação de vírus Ebola devem aplicar, além de precauções-padrão, outras medidas para evitar a infecção por qualquer exposição a sangue e fluidos corporais do paciente e contato direto sem proteção. Quando em contato próximo (até 1 metro) de pacientes com EBV, os profissionais de saúde devem usar protetor da face (uma viseira ou uma máscara médica e óculos de proteção), um vestido de mangas compridas limpo, não estéril e luvas (luvas estéreis).

Os trabalhadores do laboratório também estão em risco. As amostras retiradas de animais e humanos com suspeita de Ebola para o diagnóstico devem ser manuseado por pessoal treinado e processadas em laboratórios devidamente equipados.

 

A copa do mundo está rolando em nosso país, mas não podemos perder o foco. Estudar é preciso, para que tenhamos êxito em alcançar nossos objetivos. Hoje, trazemos a resolução da prova da 1ª fase da FUVEST aplicada em 2012, que pode ser encontrada no link abaixo:

http://www.fuvest.br/vest2012/1fase/fuv2012v.pdf

 

RESOLUÇÃO COMENTADA

12) Esta questão aborda as funções das organelas celulares, especificamente do complexo de golgi. Esta organela apresenta duas funções essenciais: secreção celular e endereçamento de moléculas. A primeira função relaciona-se com a necessidade que a célula possui de secretar (liberar) substâncias, sejam lipídios, proteínas, hormônios, etc. A segunda função está relacionada à capacidade que tal organela possui de endereçar as substâncias produzidas pela célula ao seu local de atuação. Por exemplo, o retículo endoplasmático rugoso pode produzir uma proteína que atua na membrana plasmática. Então, o retículo produzirá tal proteína e o complexo de golgi irá recebê-la e endereçá-la à membrana plasmática. O mesmo poderá ocorrer se a proteína atuar em outra região da célula. Tal regra também é válida para os lipídios. Sendo assim, a resposta correta é a letra A.

Para que não haja erros em questões relacionadas às funções das organelas, basta seguirmos as informações apresentadas na tabela abaixo:

Imagem

DICA PARA O VESTIBULAR!

A quantidade de cada uma dessas organelas pode variar em função da célula estudada. Por exemplo, uma célula que precise de grande quantidade de energia para o desempenho de suas atividades, como, por exemplo, os espermatozoides, poderá apresentar grande quantidade de mitocôndrias (responsáveis pela produção de energia). Outro exemplo é a célula hepática. O fígado participa do metabolismo de álcool e outras substâncias; por conta disso, possui grande quantidade de retículo endoplasmático liso e de peroxissomos.

 

13) Esta questão exige conhecimento sobre a resposta imunológica. Em primeiro lugar, devemos nos recordar que a resposta imune é o mecanismo de defesa do organismo contra agentes invasores. O organismo dos seres vivos é capaz de reconhecer “corpos estranhos” e possui mecanismos para destruí-los. O reconhecimento específico de um dado agente invasor caracteriza um tipo de resposta imune conhecida como resposta imune adquirida ou adaptativa. Neste processo, um grupo de células chamadas apresentadoras de antígenos reconhecem os “corpos estranhos” ou antígenos e apresentam-nos a um tipo específico de glóbulo branco chamado de linfócito T. Os linfócitos T, por sua vez, podem estimular a produção e liberação de anticorpos pelos linfócitos B ou ativar a ação dos macrófagos na fagocitose dos invasores.

No primeiro contato com o antígeno, este processo de reconhecimento e produção de anticorpos leva um tempo maior, permitindo que o invasor se multiplique e provoque a doença. No entanto, após o primeiro contato, o corpo preserva uma parte dos linfócitos T e B, formando um grupo de células conhecidas como células de memória imunológica, que são capazes de reconhecer imediatamente o antígeno no caso de um segundo contato. Sendo assim, a produção de anticorpos é mais rápida a partir do segundo contato com o antígeno. A reação imunológica ao primeiro contato é chamada de RESPOSTA IMUNE PRIMÁRIA, enquanto a reação ao segundo contato é chamada de RESPOSTA IMUNE SECUNDÁRIA. Este é o princípio que explica a razão de termos algumas doenças por uma única vez. Ele também explica o funcionamento de uma VACINA, que é induzir a criação de células de memória imunológica capazes de reconhecer um antígeno a partir de um segundo contato.

Sabendo dos conceitos acima apresentados, podemos analisar as situações propostas na questão:

 – Inicialmente, injetou-se uma dose de proteína A no camundongo. Após quatro semanas, injetou-se uma nova dose de proteína A, juntamente com uma dose de proteína B.

Sendo assim, pede-se para analisar o gráfico e assinalar a afirmativa correta. Ao observarmos o gráfico, vemos que após a primeira injeção de proteína A, a quantidade de anticorpos aumenta até certo nível, como mostrado na curva X. Em seguida, após a injeção das proteínas A e B, vemos uma curva Y de igual formato a curva X e a curva Z, que apresenta concentração de anticorpos muito superior. Repare que na curva X só tínhamos injeção da proteína A; logo, os anticorpos gerados irão combater essa proteína, o que caracteriza a resposta imune primária. Então, deu-se a segunda injeção. Repare que o camundongo já havia tido contato com a proteína A; logo, nesse segundo contato, a produção de anticorpos será muito maior, o que é observado na curva Z, caracterizando a resposta imune secundária a esse antígeno. A curva Y, por sua vez, representa a resposta imune primária contra a proteína B (o camundongo estava tendo o primeiro contato com este antígeno).

Com base nisso, podemos deduzir que a alternativa A é a resposta correta. 

 

14) Esta questão requer conhecimentos sobre dois processos essenciais: acomodação visual e adaptação a claro e escuro. Além disso, exige-se a compreensão das duas estruturas envolvidas nestes processos: cristalino e íris.

– A íris é um disco que dá cor aos olhos e possui uma abertura chamada de pupila (que atua como um diafragma de uma câmera fotográfica). Ela irá controlar a quantidade de luz que penetra no olho. Isso é um importante mecanismo para que o olho se adapte às condições de claro e escuro. Sendo assim, em condições de claridade maior, a íris aumenta, diminuindo a abertura da pupila; em condições de penumbra (menor intensidade luminosa), por sua vez, a íris diminui, provocando o aumento da abertura da pupila.

Ao analisarmos a questão, vemos que se pergunta o que ocorrerá com a íris quando uma pessoa passa para um ambiente de penumbra. Por estar no escuro, a íris diminuirá, provocando uma maior abertura da pupila. Analisando as alternativas, vemos que somente as letras B, C e E apresentam tal resposta.

Agora devemos analisar a questão da acomodação visual, que é responsabilidade do cristalino:

– O cristalino é uma lente transparente, que recebe a luz que penetrou através da pupila e é responsável pela focalização da imagem. No caso de imagem ou objetos próximos, os músculos ciliares contraem-se e tornam o cristalino mais arredondado, aumentando seu poder de refração; quando se fala em objetos mais distantes (visão de longa distância), os músculos ciliares relaxam e tornam a lente mais alongada.

No enunciado da questão fala-se em objetos próximos. Portanto, os músculos ciliares estarão contraídos, aumentando o poder de refração do cristalino.

Sendo assim, a resposta correta é a letra B.

 

15) Para resolver esta questão, devemos recordar qual a taxonomia das plantas e as principais características de cada grupo de vegetais. Para isso, iremos utilizar a tabela abaixo:

Imagem

Agora, podemos resolver a questão sem maiores dificuldades:

– A primeira afirmativa diz que o grupo evolutivamente mais antigo possui fase haploide mais duradoura que a diploide. De acordo com a tabela, os mais antigos são as briófitas e possuem a característica mencionada. Logo, afirmativa I correta.

– A segunda afirmativa diz que os grupos que possuem fase diploide mais desenvolvida, possuem também raiz, caule e folhas verdadeiros. Os grupos com fase diploide predominante são as Pteridófitas, Gimnospermas e Angiospermas e realmente todos possuem estes órgãos. Logo, a afirmativa II está correta.

– A terceira afirmativa fala em grupos de plantas que possuem fase haploide e diploide de igual duração. Isso não é observado nos grupos de vegetais terrestres. Logo, a afirmativa III está errada. Outro tópico errado é o fato de dizer que esses vegetais possuem rizoides, cauloides e filoides (raiz, caule e folhas não verdadeiros). Vimos na tabela acima, que apenas as briófitas possuem esta característica e as mesmas possuem fase haploide predominante.

Sabendo que as afirmativas I e II estão corretas, a alternativa que responde a questão é a letra D. 

 

16) O enunciado da questão apresenta uma série de eventos que ocorrem durante a multiplicação (divisão) celular. E pede-se para indicar quais eventos estão relacionados com a separação equitativa do material genético. Para isso, devemos diferenciar os processos de mitose e meiose. Repare que a meiose possui duas divisões, a meiose I e a meiose II. A meiose II é rigorosamente igual ao processo de mitose. Então, apresentaremos uma tabela comparando a mitose e a meiose I:

Imagem

Para resolver esta questão, devemos avaliar qual tipo de divisão celular está sendo mencionado. Repare que fala-se em reparação tecidual. Este processo deve-se a ocorrência da mitose, um processo em que as células-filhas possuem a mesma quantidade de material genético que a célula-mãe. Então, devemos nos perguntar: “Das quatro afirmativas apresentadas quais delas estão relacionadas com a mitose e com a separação equitativa do material genético?”. Se analisarmos com atenção, veremos que somente as afirmativas II e IV estão relacionadas com a mitose. Logo, a resposta correta é a letra B.

 

DICAS IMPORTANTES ABAIXO!

ImagemImagem

 

 

17) Esta questão aborda temas mais relacionados com geografia, envolvendo conhecimento sobre características de vegetação e clima das regiões apresentadas no mapa. Ao analisarmos o mapa, podemos verificar que os bandeirantes partiam do estado de São Paulo, que é caracterizado pela presença da Mata Atlântica na região mais litorânea e por grandes áreas de florestas densas.

Sabendo disso, podemos dizer que o ponto de partida eram áreas de florestas mais densas. Logo, podemos eliminar as alternativas A e E, visto que elas consideram que São Paulo não é formado por áreas florestais e nem por florestas mais densas.

Em seguida, devemos avaliar a vegetação característica dos estados de destino: Minas Gerais, Goiás e Mato Grosso. O estado do Mato Grosso é caracterizado pela presença do Pantanal e possui uma área componente da Amazônia Legal. Goiás e Minas Gerais possuem áreas extensas de cerrado, que caracterizam-se pela vegetação com menor quantidade de árvores e altamente esparsa. Sabendo disso, podemos eliminar a alternativa B.

Por fim, precisamos analisar a questão das estações secas e do período de chuvas. Com relação a isso, podemos dizer que era bastante variável, alternando períodos mais secos, como, por exemplo, o inverno no Mato Grosso e certas épocas em Goiás com períodos de chuva intensa, que são observadas sobretudo no estado do Mato Grosso.

Sendo assim, a resposta correta é a letra D.

 

18) Esta questão envolve conhecimentos sobre os ácidos nucleicos e código genético. É importante lembrarmos quais as diferenças entre o DNA e o RNA:

Imagem

Analisando a molécula apresentada na questão, vemos que ela possui uracila (U). Portanto, trata-se de uma molécula de RNA. Sendo assim, somente as alternativas D e E podem estar corretas.

Agora precisamos determinar quantos aminoácidos são encontrados entre o sítio de iniciação e o sítio de mutação. Para isso, devemos nos recordar do seguinte conceito:

“O código genético é representado por trincas de nucleotídeos, ou seja, cada trinca de letras apresentada indica um aminoácido.”

 Então, vamos analisar a situação. O sítio de iniciação da tradução é representado sempre pela trinca AUG. Então, precisamos verificar quantas trincas existem entre AUG e a mutação. Ao fazermos isso, verificamos que existem 24 nucleotídeos (letras) e, portanto, teremos oito trincas. Se há oito trincas, teremos também oito aminoácidos. Sendo assim, a resposta correta é a letra D.

 

19) Esta questão aborda a genética, enfatizando o estudo da herança de duas características ao mesmo tempo (diibridismo). As características estudadas são: a altura das plantas e a cor do fruto.

De acordo com Mendel, cada característica será determinada por um par de genes. Como a questão não menciona nenhuma letra para representar cada característica, consideraremos os genes A e a para a altura da planta e os genes B e b para a cor do fruto.

Uma vez que fizemos isso, podemos determinar quais os genótipos possíveis para cada característica. Repare que o enunciado diz que a característica planta alta é dominante. Logo, as plantas altas possuirão o gene dominante e serão AA ou Aa; as plantas anãs, por sua vez, serão aa. Agora observe que a característica frutos vermelhos é dominante também. Logo, os frutos vermelhos possuirão o gene dominante e serão BB ou Bb; os frutos amarelos, por sua vez, serão bb.

Então, devemos analisar o que o enunciado nos diz. Ele fala que um agricultor cruzou linhagens puras de plantas altas/frutos vermelhos com plantas anãs/frutos amarelos. Mas o que é mesmo uma linhagem pura?

“Linhagens puras de organismos são aquelas obtidas por autofecundação, em que os indivíduos só possuem cópias de um mesmo gene, ou seja, possuem dois genes dominantes (AA ou BB) ou dois genes recessivos (aa).” 

Então, vamos pensar: “Qual o genótipo de linhagens puras de plantas altas com frutos vermelhos? E das plantas anãs com frutos amarelos?”. Se estamos falando em linhagens puras, as plantas altas com frutos vermelhos deverão possuir só cópias de genes dominantes, visto que a característica é dominante. Logo, seu genótipo será AABB. Com relação às plantas anãs com frutos amarelos, podemos dizer que elas só possuirão genes recessivos. Portanto, seu genótipo será aabb.

Após isso, diz-se que o agricultor pretendia obter uma linhagem de plantas anãs com frutos vermelhos e, para isso, permitiu que os descendentes do cruzamento acima apresentado (AABB x aabb) cruzassem entre si, obtendo-se 320 plantas. Então, pergunta-se quantas plantas da linhagem desejada foram obtidas e o cruzamento que se deve fazer para sempre obter as plantas da linhagem desejada.

Para resolver isso, precisamos, em primeiro lugar, descobrir quais os descendentes do primeiro cruzamento (AABB x aabb). Para isso, iremos realizar o cruzamento separado de cada par de genes AA x aa e também BB x bb.

 

– Cruzamento AA x aa

Imagem

– Cruzamento BB x bb

 Imagem

Repare que no cruzamento AABB x aabb produzimos 100% de indivíduos AaBb. Agora, devemos cruzar dois indivíduos AaBb entre si, para que possamos descobrir quantas plantas anãs e de fruto vermelho foram formadas. Para isso, vamos realizar o cruzamento de cada par de genes separadamente:

 

– Cruzamento Aa x Aa

Imagem

– Cruzamento Bb x Bb

 Imagem

Então, devemos verificar qual a probabilidade de formar plantas anãs (aa) e com frutos vermelhos (BB ou Bb) separadamente. No primeiro cruzamento, vemos que apenas um indivíduo formado de um total de quatro possui a característica planta anã; logo, a probabilidade de formarmos plantas anãs é de 1/4. No segundo cruzamento, vemos que três indivíduos formados de um total de quatro possuem a característica frutos vermelhos; logo, a probabilidade de formamos plantas com frutos vermelhos é ¾. Como descobrir a probabilidade de possuir ambas as características? Basta multiplicarmos as probabilidades individuais, como mostrado abaixo:

P (plantas anãs com frutos vermelhos)= P(plantas anãs) x P(frutos vermelhos)

P(plantas anãs com frutos vermelhos)= ¼ x 3/4 = 3/16

Sabendo que a probabilidade é igual a 3/16 e que este cruzamento gerou 320 descendentes, podemos descobrir quantas dessas plantas são anãs e com frutos vermelhos. Basta multiplicarmos, o número total de descendentes pela probabilidade:

3/16 x 320= 60 indivíduos com plantas anãs e frutos vermelhos.

Sabendo disso, somente as alternativas D ou E podem estar corretas.

Agora devemos avaliar qual cruzamento produz plantas anãs com frutos vermelhos. Para obtermos sempre plantas anãs e com frutos vermelhos, precisamos cruzar sempre plantas homozigotas recessivas com relação à altura das plantas (aa) e homozigotas dominantes com relação à cor do fruto (BB). Sendo assim, a resposta correta é a letra E. 

 

20) Esta questão aborda a temática do crescimento das plantas que faz referência à fisiologia vegetal. Para resolvê-la, devemos nos recordar das condições necessárias ao crescimento do vegetal.

As plantas são organismos autótrofos e, portanto, são capazes de produzir seu próprio alimento por meio da fotossíntese. Para tal, a planta necessita de luz, água e gás carbônico. Ao analisarmos as duas situações apresentadas na questão, plantas no algodão e plantas em um vaso, podemos verificar que essas condições são obedecidas nos dois casos. Contudo, a planta também necessita de uma série de micronutrientes, somente encontrados no solo, para completar o seu desenvolvimento. Sendo assim, as plantas presentes no algodão não conseguiriam crescer devidamente e, provavelmente, irão morrer devido à falta desses nutrientes.

Sabendo disso, podemos dizer que a única alternativa que apresenta uma resposta coerente com o que foi mencionado acima é a letra B.

  

21) A questão aborda a evolução dos vertebrados, que estão divididos em cinco grupos: peixes, anfíbios, répteis, aves e mamíferos. Vamos analisar cada afirmativa e discuti-las separadamente:

– Alternativa A: o grupo mais recente de vertebrados são os mamíferos. A passagem dos alimentos por estômago e intestino já é observada em outros grupos, como os répteis e as aves. Portanto, tal afirmação é incorreta.

– Alternativa B: a circulação sofreu modificações ao longo da evolução dos vertebrados. Uma mudança marcante foi a alteração na quantidade de cavidades cardíacas (peixes possuem somente duas cavidades, anfíbios e alguns répteis possuem três cavidades, enquanto os crocodilianos, aves e mamíferos possuem quatro cavidades). Contudo, somente nos grupos dos crocodilianos, aves e mamíferos é que a circulação sistêmica é completamente separada da circulação pulmonar (não há mistura de sangue venoso com sangue arterial). Sendo assim, tal afirmação está incorreta.

– Alternativa C: a respiração celular manteve-se igual em todos os grupos ao longo da evolução. A única mudança observada é a estrutura responsável pelas trocas gasosas em cada grupo. A maioria dos peixes respira através de brânquias (a exceção são alguns peixes de água doce que são pulmonados). Os anfíbios apresentam como principal forma a respiração pulmonar, mas também são capazes de realizar trocas gasosas através da pele (respiração cutânea). Os répteis, as aves e os mamíferos apresentam respiração pulmonar. Logo, a afirmativa está correta.

– Alternativa D: a excreção é realmente variável nestes grupos. Contudo, o tipo de excreta eliminada por cada grupo irá depender do ambiente onde vivem. A amônia, um resíduo bastante solúvel em água, costuma ser eliminada por peixes e girinos. O ácido úrico, um resíduo pouquíssimo solúvel em água, é eliminado por grupos adaptados à ambientes de clima mais seco (como os répteis e aves). Os mamíferos e anfíbios, por sua vez, eliminam principalmente ureia.  Sendo assim, tal afirmativa está incorreta.

– Alternativa E: os peixes apresentam reprodução dependente de água. Contudo, a transição do meio aquático para o terrestre não envolve a formação de indivíduos totalmente independentes de água para a sua reprodução. Os anfíbios, primeiro grupo de vertebrados terrestres, reproduzem-se na água e seu estágio larvar (o girino) vive na água. Portanto, a alternativa está incorreta.

Sendo assim, a resposta correta é a letra C.

 

22) Esta questão fala sobre o efeito estufa, processo natural responsável pelo aquecimento do planeta. No enunciado, diz-se que uma das consequências desse processo é o aumento da temperatura nos oceanos e pergunta-se o que isso provoca. É importante lembrar que a temperatura afeta a dissolução do oxigênio e do gás carbônico nas águas oceânicas. Contudo, precisamos avaliar as justificativas apresentadas nas alternativas. Para auxiliá-los, lembrem-se:

– Uma redução na dissolução do gás carbônico faz com que o fitoplâncton (algas) captem menor quantidade de gás carbônico e, consequentemente, o efeito estufa se intensifique.

– A redução na dissolução de oxigênio diminuirá a quantidade de oxigênio dissolvido na água, podendo provocar a morte de seres vivos componentes da biota.

Sabendo disso, podemos verificar que a única alternativa que apresenta uma resposta coerente é a letra A.

 

BONS ESTUDOS!!!!

Vamos lá galerinha!!!

O primeiro exame de qualificação da UERJ já passou e agora temos que nos preparar para o segundo exame de qualificação, que será em Setembro. Hoje trago o comentário das questões de Biologia presentes na prova de domingo passado, com direito a um comentário detalhado da questão 41, que deixou muitos alunos confusos com seu enunciado. Felizmente, a questão foi anulada pela universidade. Vamos estudar!

 

30) Esta questão requer conhecimento sobre o processo evolutivo das plantas terrestres. Para resolvê-la, basta termos conhecimento sobre as principais características dos quatro grupos de vegetais.

– Briófitas: são os vegetais mais simples encontrados em ambiente terrestre e caracterizam-se por serem avasculares (não possuem vasos condutores de seiva) e por viverem em ambientes úmidos. Além disso, sua reprodução é dependente de água. Os principais exemplos desse grupo são os musgos, hepáticas e antóceros;

– Pteridófitas: são vegetais vasculares (possuem vasos condutores de seiva) e reprodução dependente de água. As samambaias e avencas são os principais representantes deste grupo;

– Gimnospermas: são vegetais vasculares e possuem sementes e reprodução independente de água. Os pinheiros, encontrados na mata de araucárias, são os principais representantes deste grupo;

– Angiospermas: são vegetais vasculares, que possuem sementes e frutos e reprodução independente de água. As árvores frutíferas são os principais representantes deste grupo.

Tendo em vista as informações acima, podemos dizer que pteridófitas, gimnospermas e angiospermas formam um grupo de vegetais chamados vegetais vasculares, pois possuem tecidos condutores de seiva. Além disso, gimnospermas e angiospermas, formam um grupo chamado de fanerógamas, pois possuem sementes e reprodução independente de água.

Sabendo disso, podemos analisar o cladograma. A característica A está presente em todos os grupos de vegetais terrestres. A característica B está presente somente em pteridófitas, gimnospermas e angiospermas. A característica C, por sua vez, está presente somente em gimnospermas e angiospermas. Sabendo disso, podemos deduzir que as características B e C são, respectivamente, a presença de tecidos vasculares e a presença de sementes. Ao analisarmos as alternativas, vemos que só o item D apresenta tal resposta e, portanto, é a resposta correta.

 

31) Esta questão poderia ser resolvida do ponto de vista da química ou da biologia. O enunciado fala sobre a queima de combustíveis fósseis e seus impactos sobre a intensidade do efeito estufa e pergunta-se qual óxido ácido seria o principal responsável por esse processo. Do ponto de vista da biologia, basta lembrar que o CO2 é o principal gás responsável pelo aquecimento do planeta. Do ponto de vista da química, basta lembrar que o processo de combustão completo produz, geralmente, gás carbônico e água.

 

35) Esta questão aborda o tópico sobre osmorregulação em peixes. Para resolvê-la, vamos compreender a situação apresentada na questão. O enunciado fala sobre espécies de peixes que vivem em água doce, mas que conseguem sobreviver mesmo em condições nas quais a salinidade está mais elevada. Analisemos como estará a concentração de sais em um peixe de água doce:

“Em água doce, a concentração de sais é relativamente baixa, de modo que os peixes que vivem nesse ambiente apresentam maior concentração de sais no interior das suas células, ou seja, o meio da água doce é hipotônico (menos concentrado) em relação ao interior das células dos peixes.”

Se a concentração de sais é maior no interior das células, a tendência é que haja entrada de água nas células do peixe, provocando um aumento no volume celular. Para compensar essa entrada excessiva de água, os peixes de água doce tendem a formar grande quantidade de urina, para eliminar esse excesso de água.

Agora vamos analisar a situação apresentada na questão: diz-se que um rio sofreu um processo de salinização, ou seja, houve aumento na concentração de sais e que o peixe responde eliminando mais urina e reabsorvendo mais sais. Se o animal está eliminando mais urina, ele estará eliminando mais água. Com isso, podemos dizer que, por eliminar mais água, o animal estará em um meio com concentração mais elevada. Ao analisarmos as alternativas, vemos que o trecho Y é aquele que apresenta maior concentração de sais e também não está muito distante da concentração original. Logo, a resposta correta é o item C.

  

37) Esta questão poderia ser resolvida tanto pela química quanto pela biologia. No enunciado, fala-se sobre um tipo de interação química que é responsável pelo pareamento de bases no DNA. Com essa informação, devemos nos perguntar qual tipo de interação química é responsável pela união da dupla fita de DNA. A resposta é simples: PONTES DE HIDROGÊNIO. Do ponto de vista da química, bastava lembrarmos que as moléculas de água encontram-se altamente coesas e unidas por conta das pontes de hidrogênio formadas entre elas. Logo, a resposta correta é a letra C.

 

39) O enunciado desta questão fala sobre a presença de membranas interdigitais em embriões de alguns vertebrados. Uma membrana interdigital é um pedaço de tecido localizado entre os dedos, que é observado em algumas espécies adultas, como, por exemplo, em anfíbios aquáticos e algumas aves. No enunciado, diz-se que, em determinado momento do desenvolvimento, o citoplasma da célula libera enzimas que digerem essas membranas. Essa informação é crucial para a resolução da questão. Repare que ele fala em enzimas e digestão. Somente uma organela citoplasmática possui função de digestão intracelular e é conhecida como LISOSSOMO. Logo, a resposta correta é a letra A.

 

41) Esta questão apresenta um tópico que a UERJ tradicionalmente em suas provas, que é a ocorrência de mutações e as possíveis alterações na sequência de aminoácidos de uma proteína. Comentei sobre isso no facebook do blog e também apresentei resoluções de algumas questões sobre tal assunto anteriormente.

O enunciado fala sobre a ocorrência de mutações no RNAm (RNA mensageiro).Lembre-se que mutações são alterações que ocorrem na sequência de DNA e que, consequentemente, podem alterar a o RNAm (produzido a partir de sequências de DNA). Isso seria um erro conceitual da questão.

Ainda no enunciado, diz-se que podem ocorrer substituições simultâneas de bases nitrogenadas adjacentes. Uma substituição é a troca de um nucleotídeo contendo uma dada base nitrogenada por outro nucleotídeo contendo uma base diferente. Sendo assim, a substituição não altera a quantidade de nucleotídeos presentes na sequência de RNAm mensageiro. Essa informação é de grande valia!

Então, pergunta-se qual alternativa apresenta o número de substituições que irá provocar maior alteração na estrutura da proteína formada.

Para alterar a proteína formada, é necessário que haja alteração na sequência de seus aminoácidos, que é determinada pela sequência do RNA mensageiro. Lembre-se que cada trinca de nucleotídeos (cada trinca de letras) do RNAm é chamada de códon e cada uma delas indica um aminoácido específico.

Para compreendermos essa questão e possamos analisá-la, vamos usar uma sequência aleatória:

 

AUGGCCCCAUUUGUGGCAUAG

 

Tendo em vista as informações acima, analisemos cada alternativa:

 

1) Letra A: diz que ocorrem 3 substituições. Se houvessem substituições em três bases adjacentes (que estão uma ao lado da outra), haveriam as seguintes possibilidades:

 – Troca de uma trinca inteira, como mostrado abaixo:

 Sequência normal: AUGGCCCCAUUUGUGGCAUAG

Sequência alterada: AUGCAACCAUUUGUGGCAUAG

Repare que trocamos um códon inteiro. Então, se trocamos um códon, poderíamos trocar um aminoácido.

 

– Troca de dois nucleotídeos numa trinca e um nucleotídeo em outra trinca, como mostrado abaixo:

Normal: AUGGCCCCAUUUGUGGCAUAG

Alterada: AUGGCCCCAUGGCUGGCAUAG

Repare que trocamos duas bases na trinca UUU, que passou a ser UGG. E trocamos uma base na trinca GUG, que passou a ser CUG. Neste caso, poderíamos trocar até dois aminoácidos.

 

2) Letra B: diz que ocorre 4 substituições. Neste caso, teríamos duas possibilidades:

– Troca de uma trinca inteira e mais uma base em outra trinca, como mostrado abaixo:

Normal: AUGGCCCCAUUUGUGGCAUAG

Alterada: AUGCAAGCAUUUGUGGCAUAG

Repare que aqui podemos trocar uma trinca inteira (GCC por CAA) e mais uma base de outra trinca (CCA por GCA). Neste caso, estamos alterando até dois códons e, portanto, poderíamos modificar dois aminoácidos.

 

-Troca de duas bases em um códon e outras duas bases em outro códon:

Normal: AUGGCCCCAUUUGUGGCAUAG

Alterada: AUGGGGGGAUUUGUGGCAUAG 

Repare que aqui poderia estar trocando GCC por GGG (mudei duas bases C por G) e CCA por GGA (mudei duas bases C por G). Neste caso, estou alterando dois códons e, portanto, poderia mudar dois aminoácidos.

 

3) Letra C: diz-se que ocorre 6 substituições nas bases adjacentes. Com isso, teríamos as seguintes possibilidades:

– Troca de dois códons inteiros, como mostrado abaixo:

Normal: AUGGCCCCAUUUGUGGCAUAG

Alterada: AUGCCAGGUUUUGUGGCAUAG

Repare que aqui estamos modificando duas trincas inteiras. Sendo assim, estaríamos modificando dois aminoácidos.

 

– Troca de duas bases em uma trinca, três bases em outra trinca e uma base em outra trinca, como mostrado abaixo:

Normal: AUGGCCCCAUUUGUGGCAUAG

Alterada: AUGGCCCGUAAACUGGCAUAG

Repare que modificamos duas bases na trinca CCA, que passou a ser CGU. Depois modificamos toda a trinca UUU, que passou a ser AAA. Por fim, modificamos uma base na terceira trinca, que de GUG passou a ser CUG. Se alteramos três trincas, poderíamos alterar três aminoácidos.

 

4) Letra D: diz que houve 9 substituições. Neste caso, teríamos as seguintes possibilidades:

– Mudança de três códons inteiros, como mostrado abaixo:

Normal: AUGGCCCCAUUUGUGGCAUAG

Alterada: AUGCAAGGUAAAGUGGCAUAG

Repare que modificamos três códons inteiros: GCC por CAA, CCA por GGU e UUU por AAA. Neste caso, como mudamos três códons, poderíamos ter alteração de três aminoácidos.

 

– Mudança de duas bases em um códon, dois códons inteiros e uma base em outro códon:

Normal: AUGGCCCCAUUUGUGGCAUAG

Alterada: AUGGGGGGUAAACUGGCAUAG

Repare que mudamos duas bases na primeira trinca (GCC para GGG). Em seguida, mudamos dois códons inteiros (CCA por GGU e UUU por AAA) e, por fim, mudamos a primeira base de um códon (GUG por CUG). Neste caso, alteramos quatro códons e, portanto, podemos alterar quatro aminoácidos.

Essa seria a lógica de resolução desta questão, considerando a ocorrência de substituições e que sempre ocorreria mudança nos aminoácidos. Sendo assim, a resposta correta seria letra D. Contudo, repare que disse que necessitaríamos considerar que sempre haveria troca do aminoácido. Porque falei isso? O código genético é degenerado, ou seja, um mesmo aminoácido pode ser codificado por várias trincas (códons), de modo que podem ocorrer mudanças na sequência que não alteram o aminoácido. Essa seria outra razão que dificulta a resolução da questão.

Em função dessas dificuldades, a universidade optou por anular esta questão. Analisando-a com calma, acredito que a intenção da universidade era abordar um tipo específico de alteração no DNA, que envolve os processos de inserção e deleção.

A inserção ou a deleção de um único nucleotídeo é capaz de provocar uma alteração completa na sequência de códons no RNAm. Observe abaixo: 

– Inserção de um nucleotídeo:

Normal: AUGGCCCCAUUUGUGGCAUAG

Alterada: AUGUGCCCCAUUUGUGGCAUAG

Repare que coloquei uma base U logo depois do códon AUG. Essa única inserção modificará toda a sequência de códons. Na sequência normal, os códons seriam: AUG, GCC, CCA, UUU, GUG, GCA e UAG. Na sequência alterada, os códons seriam: AUG, UGC, CCC, AUU, UGU, GGC e AUA. Sendo assim, poderíamos estar alterando todos os aminoácidos que vem depois da mutação.

 

– Deleção de um nucleotídeo:

Normal: AUGGCCCCAUUUGUGGCAUAG

Alterada: AGGCCCCAUUUGUGGCAUAG

Repare que deletei a base U presente no códon AUG. Essa deleção alterará toda a ordem dos códons nessa sequência. A sequência normal tinha os códons: AUG, GCC, CCA, UUU, GUG, GCA e UAG. A sequência alterada apresentará os códons: AGG, CCC, CAU, UUG, UGG e CAU.

SE LIGA!!

Publicado: 29 de maio de 2014 em Sem categoria

Acessem o facebook do blog!

https://www.facebook.com/seliganabiologia